Entry information : ZmPrx109 (GRMZM2G150731)
Entry ID 1005
Creation 2005-12-13 (Christophe Dunand)
Last sequence changes 2014-01-16 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-27 (Christophe Dunand)
Peroxidase information: ZmPrx109 (GRMZM2G150731)
Name (synonym) ZmPrx109 (GRMZM2G150731)
Class Class III peroxidase    [Orthogroup: Prx147]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx109
start..stop
S start..stop
HvPrx64 399 3e-139 6..360 8..356
HvPrx40 394 2e-137 18..360 17..353
HvPrx104 392 8e-137 18..360 17..354
TaPrx47 390 1e-135 6..360 11..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 168994856..168995197 342 N° 2 168994028..168994771 744  
complement(join(168994028..168994771,168994856..168995197))


exon

Literature and cross-references ZmPrx109 (GRMZM2G150731)
Literature Wen,T.J. et al., unpublished
Protein ref. UniProtKB:   B4FYH1
DNA ref. GenBank:   AC195916.2 (14387..15553)
mRNA ref. GenBank:   BT042159
Cluster/Prediction ref. UniGene:   Zm.8327
Protein sequence: ZmPrx109 (GRMZM2G150731)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (339)
PWM (Da):   %s   37911.89 (35744.7)  
PI (pH):   %s   6.28 (5.82) Peptide Signal:   %s   cut: 23 range:23-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKPAAALVMLLALVAAGPAAGDGGSTRLGCFVGWSPLKTVSSLLCLLQGSSTFPSPKPAPTGQGLSVGYYNKSGSCPKAEQLVREAVTSATNGANRGLNAGLIRLHFHDAFVRGCDASVLLDKTASNNTDTEKTGPPNKDSLRGFEVIDAAKAAVEKECPGIVSCADILAFAARDASYILSNEKIYYEVPAGRYDGRESFADETDQLPGPGSSVQDLKKSFAAQGLSLADAVTLSGAHSIGLARCLFFKDRLSAMDPGYAATLNATCNAGGDSYKVNQDYKSPDVLDNQYYKNIDKFVLFASDAALKSSETIDQVNANAGGYGKWEKDFGDAMVKMGKIGVITSPGYGAEIRKVCSQINY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7 (AC186568, AC195916 and Phytozome) and chromo 1 (AC191997)), intron 1) and 4 ESTs. Cultivar="B73". Missing cystein residues. Containing motif FHDC instead of FHDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTAAGCCGGCTGCGGCCCTAGTGATGTTGCTGGCGCTCGTCGCCGCCGGGCCGGCGGCGGGCGACGGGGGGAGCACCAGACTCGGCTGCTTCGTGGGTTGGTCCCCGCTCAAAACC
GTGTCCTCCCTGCTCTGCCTGCTCCAGGGCTCCAGCACTTTTCCGAGCCCGAAGCCTGCGCCCACGGGGCAGGGCCTGAGCGTCGGTTACTACAACAAAAGCGGCAGCTGCCCTAAAGCG
GAGCAGCTCGTGAGGGAAGCCGTGACGAGTGCCACCAACGGCGCAAACCGTGGCCTTAACGCGGGCCTCATCCGTCTCCACTTCCACGACGCCTTCGTTCGG
GTAATAAAATAAAAATCG
TCGTCGTCGTCGTCATGATCAGCAGCAGCTAGCAATAATAATAACACTCCATCGTCATCCATTCAGGGCTGCGATGCTTCCGTTCTCCTGGACAAGACCGCGTCGAACAACACCGACACG
GAGAAGACAGGCCCACCCAACAAGGACAGCCTGCGCGGCTTCGAAGTGATCGACGCGGCCAAGGCGGCGGTGGAGAAAGAGTGCCCCGGCATCGTCTCGTGCGCCGACATCCTGGCCTTC
GCCGCGCGCGACGCGTCCTACATCCTCAGCAACGAGAAGATCTACTACGAGGTGCCGGCCGGCCGCTACGACGGGCGCGAGTCCTTCGCCGACGAGACCGACCAGCTGCCCGGGCCGGGC
TCCAGCGTCCAGGACCTCAAGAAGAGCTTCGCCGCCCAGGGGCTCAGCCTAGCGGACGCCGTCACGCTGTCGGGCGCGCACAGCATCGGCCTCGCCCGCTGCCTCTTCTTCAAAGACCGC
CTGTCGGCCATGGACCCCGGATACGCTGCCACGCTGAATGCCACCTGCAACGCTGGCGGGGACAGCTACAAGGTGAACCAGGACTACAAGAGCCCCGACGTCCTGGACAACCAGTACTAC
AAGAACATCGACAAGTTCGTGCTCTTCGCGTCGGACGCTGCGCTCAAGTCCAGCGAGACGATTGACCAGGTGAATGCCAACGCCGGCGGTTATGGCAAGTGGGAGAAAGACTTCGGGGAC
GCCATGGTGAAGATGGGCAAGATCGGGGTCATCACCAGCCCCGGCTACGGTGCCGAGATCAGGAAGGTGTGCTCGCAGATCAACTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTAAGCCGGCTGCGGCCCTAGTGATGTTGCTGGCGCTCGTCGCCGCCGGGCCGGCGGCGGGCGACGGGGGGAGCACCAGACTCGGCTGCTTCGTGGGTTGGTCCCCGCTCAAAACC
GTGTCCTCCCTGCTCTGCCTGCTCCAGGGCTCCAGCACTTTTCCGAGCCCGAAGCCTGCGCCCACGGGGCAGGGCCTGAGCGTCGGTTACTACAACAAAAGCGGCAGCTGCCCTAAAGCG
GAGCAGCTCGTGAGGGAAGCCGTGACGAGTGCCACCAACGGCGCAAACCGTGGCCTTAACGCGGGCCTCATCCGTCTCCACTTCCACGACGCCTTCGTTCGG
GGCTGCGATGCTTCCGTT
CTCCTGGACAAGACCGCGTCGAACAACACCGACACGGAGAAGACAGGCCCACCCAACAAGGACAGCCTGCGCGGCTTCGAAGTGATCGACGCGGCCAAGGCGGCGGTGGAGAAAGAGTGC
CCCGGCATCGTCTCGTGCGCCGACATCCTGGCCTTCGCCGCGCGCGACGCGTCCTACATCCTCAGCAACGAGAAGATCTACTACGAGGTGCCGGCCGGCCGCTACGACGGGCGCGAGTCC
TTCGCCGACGAGACCGACCAGCTGCCCGGGCCGGGCTCCAGCGTCCAGGACCTCAAGAAGAGCTTCGCCGCCCAGGGGCTCAGCCTAGCGGACGCCGTCACGCTGTCGGGCGCGCACAGC
ATCGGCCTCGCCCGCTGCCTCTTCTTCAAAGACCGCCTGTCGGCCATGGACCCCGGATACGCTGCCACGCTGAATGCCACCTGCAACGCTGGCGGGGACAGCTACAAGGTGAACCAGGAC
TACAAGAGCCCCGACGTCCTGGACAACCAGTACTACAAGAACATCGACAAGTTCGTGCTCTTCGCGTCGGACGCTGCGCTCAAGTCCAGCGAGACGATTGACCAGGTGAATGCCAACGCC
GGCGGTTATGGCAAGTGGGAGAAAGACTTCGGGGACGCCATGGTGAAGATGGGCAAGATCGGGGTCATCACCAGCCCCGGCTACGGTGCCGAGATCAGGAAGGTGTGCTCGCAGATCAAC
TACTAG

Retrieve as FASTA