Entry information : OsPrx09(LOC_Os01g18950)
Entry ID 1019
Creation 2009-01-08 (Christophe Dunand)
Last sequence changes 2011-02-15 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-09 (Christophe Dunand)
Peroxidase information: OsPrx09(LOC_Os01g18950)
Name OsPrx09(LOC_Os01g18950)
Class Class III peroxidase    [Orthogroup: Prx284]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx09
start..stop
S start..stop
OsPrx10 573 0 1..347 1..344
SiPrx08 356 5e-123 23..347 24..344
SbPrx58 353 1e-121 11..347 6..344
SbPrx59 349 4e-120 22..347 24..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..231 231 N° 2 322..507 186 N° 3 546..1133 588  
join(1..231,322..507,546..1133)


exon

Literature and cross-references OsPrx09(LOC_Os01g18950)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1T4
DNA ref. GenBank:   NC_008394.1 (10712323..10711218)
Protein sequence: OsPrx09(LOC_Os01g18950)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (328)
PWM (Da):   %s   36402.33 (34354.2)  
PI (pH):   %s   6.03 (5.35) Peptide Signal:   %s   cut: 12 range:12-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVFVVVCMLAVAFRLVAAVVVPSAAPGGLTVGYYNGKCNNVNVESIVYNTVKDFLDADRSKGAALVRLLFHDCFVRGCDGSILLDNSTANPSPEKMSGANIGIAGLDVIDAIKAKLETACPGVVSCADMVVFAGRDASRYMSNGGVSFDVPAGRLDGVVSSAADATNTLPDSKTGVATLISNFAKKGFTPEELVILSGAHSIGKAHSSNFDDRLTAPDSEINADYRDNVLNKTCKSSSAAANPTLANNIRDIDAATLGDLASYVVPAVGGDYLDNSYYKNNKNNLVLFHSDWALVGTNSTLQHVNEYAENGTLWNIDFAQALVKLSKLAMPAGSVGQIRKTCRAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1 and 2). No EST. Missing 'c'. Incorrect prediction from Phytozome (splicing error exon 3
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGTTTTCGTGGTAGTGTGCATGCTGGCGGTGGCCTTCCGGCTAGTCGCCGCGGTCGTGGTGCCGTCGGCGGCGCCGGGCGGGTTGACGGTGGGTTACTACAATGGCAAGTGCAAC
AACGTCAACGTCGAGTCCATCGTGTACAATACCGTGAAGGACTTCCTCGATGCTGATAGATCCAAGGGCGCCGCCCTCGTACGCTTGTTGTTCCATGACTGCTTCGTCAGG
GTAAACACA
ACTAATGCTCACGCAACCATGCATAATACAATCGTTCGTATTATTTATCAATTGTCTGATTACTATTCTTTTGGACATTAGGGCTGTGATGGATCGATCCTTCTTGATAATTCGACCGCA
AATCCTTCACCGGAGAAGATGTCCGGCGCGAACATCGGCATCGCGGGGCTCGACGTGATCGACGCGATCAAGGCCAAGCTCGAGACCGCGTGCCCCGGCGTCGTCTCCTGCGCCGACATG
TCGTGTTCGCGGGCCGCGACGCGTCGA
GGTACATGAGCAACGGCGGCGTCAGCTTCGACGTGCCAGCCGGCCGCCTCGACGGCGTCGTCTCCTCGGCCGCGGACGCCACGAATACCCTCC
CCGACTCCAAGACCGGCGTCGCCACGCTGATCTCCAACTTCGCGAAAAAGGGGTTCACCCCGGAGGAGCTGGTCATCCTCTCCGGCGCGCACTCCATCGGCAAGGCGCACTCCTCCAACT
TCGACGACCGCCTCACCGCGCCGGACTCCGAGATCAACGCCGACTACCGCGACAACGTCCTGAACAAGACCTGCAAGTCGTCCTCCGCCGCGGCGAACCCGACGCTGGCGAACAACATCC
GCGACATCGACGCGGCGACGCTGGGGGACCTGGCGAGCTACGTCGTCCCGGCCGTCGGCGGCGACTACCTGGACAACAGCTACTACAAGAACAACAAGAACAACCTGGTGCTGTTCCACT
CCGACTGGGCGCTCGTCGGAACCAACTCCACGCTCCAGCACGTCAACGAGTACGCCGAGAACGGCACGCTGTGGAACATCGACTTCGCGCAGGCGCTCGTCAAGCTCAGCAAGCTGGCCA
TGCCGGCGGGGAGCGTCGGCCAGATCAGGAAGACGTGCCGCGCCATCAACTAA

Retrieve as FASTA