Entry information : GluxDyPrx09
Entry ID 10207
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx09
Name GluxDyPrx09
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx09
start..stop
S start..stop
GluxDyPrx10 894 0 163..684 4..525
CcinDyPrx02 383 1e-124 56..677 4..642
PcarDyPrx 363 1e-117 228..677 94..555
BaDyPrx10 354 2e-114 208..677 75..554
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 743776..744015 240 N° 2 744066..744281 216 N° 3 744337..744366 30 N° 4 744421..744476 56
N° 5 744529..744693 165 N° 6 744750..745579 830 N° 7 745633..745798 166 N° 8 745857..745990 134
N° 9 746049..746266 218  
join(743776..744015,744066..744281,744337..744366,744421..744476,744529..744693, 744750..745579,745633..745798,745857..745990,746049..746266)


exon

Literature and cross-references GluxDyPrx09
DNA ref. JGI genome:   scaffold_19 (743776..746266)
Cluster/Prediction ref. JGI gene:   260319
Protein sequence: GluxDyPrx09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   684
PWM (Da):   %s   77361.55  
PI (pH):   %s   7.64
Sequence 726
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSFSTSSYKVHSSYNSGSPQQLVESMKFGPASNLIPRLLSPSSIRTTSSFAVNVPYKINDSDRSVDITIPPGFDTEVLFTFQQKRYKQVIVETWPNWSTKKETYHANYNPRETGKSAMPAQKNPQKLNLAFLYFADGERTPGPSRMLNIFSESNADTFTLTIISRDKGGSPPTRPADSDMYAKVILYQSDNFPPPEIDEQEKPRGQIKDQADEQNTKPNNEDEAPDLGNIQAEIVPGLNKAFEYFLFFRIENVTGFRDTMKAKMIPRISTAMLVFDMLKKKQFPANGLPKEDWEYVGCSVGFSAIGLAKLGLTDYLYDEAFQRGQRRDAKDLGDKGTESEGDFQVEWDAEFLGEIHGVFQITAHNDSKGKAFVRQLKKDFGYSRGIQVIQSISTKFRPMPHTRMEHFGFRDGISKPEIKGYTFDDELPIRFPGSPIVEPGCLLMGRKGDLEKDRRPAWAVDGSFFVFRKLKQYVPEFHNFLRQNGTRLYPDLKPDDASHKLGARMFGRWKSGTPVVLSPDRDDESISNDDKRINNFQYPGDQSKCPFAAHTQKSYPRGNLPGSNDHVFRRASITYGGELDASETETTKNDRGLLFLCYQSSIERGFKYIQQRYNNPDFPSANLRADSPGYDPIMGTIPRYMTGLNLTKTSEKLSVPLQFVEARGGEYFFMPSISTLDKIATDS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAATTCTTTCTCAACCTCCTCCTACAAGGTTCATAGCTCGTATAATTCCGGCTCTCCTCAGCAGTTGGTCGAATCGATGAAATTCGGTCCCGCATCGAACCTCATACCCCGATTACTTT
CACCGTCATCCATTCGAACCACGAGCTCCTTTGCAGTTAATGTCCCTTACAAAATTAATGACAGTGACAGATCCGTAGATATAACTATACCTCCGGGATTCGACACGGAGGTGCTCTTT
G
TGCGTCATTCGAGTATCTTTCCGTTTTTCTTCTGAGTATTATTCTTTAGACATTTCAGCAGAAAAGATACAAACAAGTCATTGTGGAAACTTGGCCAAATTGGAGTACCAAGAAAGAGAC
TTATCACGCAAACTATAATCCTAGGGAAACTGGCAAATCCGCAATGCCTGCGCAAAAAAACCCTCAAAAGCTTAACCTCGCATTCCTCTACTTCGCCGACGGGGAGCGAACACCAGGACC
CAGCAGGATGCTAAACATTTTTTCA
GTTTGTGTTTTACTTTCACATTACCTCACTCGCCTCGACACTAATGATTTTGTAGGAGAGTAATGCAGATACTTTCACATTAACTGTTAGTTAAA
AATGTTCCTGAGTTTTGAAACTCTTATCCGCATTCTGTACGTAGATCATTTCCAGGGATAAAGGCGGATCCCCACCAACTCGTCCGGCGGATAGCGATATGTGTGTCGGTCTTGGTGTTC
CCAGTAATCATCATTAACCTTTAACATCCTAGGTATGCCAAAGTGATTCTTTATCAGTCCGACAACTTCCCACCTCCCGAAATCGACGAACAAGAAAAACCCAGGGGGCAAATAAAGGAC
CAGGCCGACGAGCAGAACACTAAGCCCAATAATGAGGACGAAGCTCCGGATTTGGGCAACATTCAAGCTGAAATAGT
GTACTTTTTCACCGAGACAAGATGCCTCTGCTCAAAATTGATT
TACATTTCTCTAGACCTGGTCTCAATAAGGCATTCGAGTACTTCCTCTTTTTCAGAATCGAAAATGTCACCGGATTTCGAGATACGATGAAGGCCAAAATGATACCTAGAATTTCTACCG
CTATGCTGGTCTTCGATATGCTCAAGAAGAAGCAATTTCCTGCGAATGGTCTGCCGAAAGAGGATTGGGAATACGTTGGATGCAGTGTTGGATTCTCGGCTATAGGCCTTGCCAAACTTG
GTTTGACGGACTATCTATATGATGAGGCGTTCCAGCGCGGCCAGCGACGAGATGCAAAAGACTTGGGTGACAAAGGGACCGAGTCTGAGGGTGACTTCCAGGTAGAATGGGATGCCGAAT
TCCTCGGGGAGATACACGGAGTCTTCCAAATCACCGCTCATAATGACAGCAAGGGCAAAGCTTTCGTTCGCCAATTGAAGAAGGACTTTGGGTATTCTAGGGGCATCCAAGTGATACAAT
CTATCTCTACAAAATTCCGGCCAATGCCGCACACCAGAATGGAGCACTTTGGCTTCCGGGACGGGATCTCGAAGCCAGAGATCAAAGGTTATACATTCGATGACGAGCTTCCAATTCGTT
TCCCTGGATCCCCCATTGTTGAGCCTGGATGCCTGCTGATGGGCCGAAAGGGAGACTTGGAGAAGGACAGGCGACCTGCCTGGGCCGTTGATGGCTCGTTCTTTGTGTTTAGGAAGCTCA
AGCAATATGTCCCAGAATTCCACAATTTCCTGCGACAGAATGGGACCAGGCTATATCCAGATTTGAAGCCCGATGATGCTTCCCATAAGTTAGGAGCCAGGATGTTTGGACGTTGGAAGA
GCG
GTGGGTCATCACACCTTCGACAGGCCGCCGTCTAACTAATTATGTTTTTACAGGGACACCCGTCGTCCTCTCCCCCGATCGAGACGACGAATCCATCTCTAATGATGATAAGCGGAT
TAATAACTTCCAGTACCCCGGCGACCAATCAAAGTGCCCATTCGCAGCTCATACGCAGAAATCTTATCCTCGTGGTAATCTTCCTGGAAGCAACGATCATGT
GTGAGGATTATTCTTGGG
AGATGCTTTGTATTTCAGCTACCTACTTATCTGTCAACAGATTCAGACGAGCTAGTATTACTTATGGCGGGGAGCTGGACGCATCTGAAACCGAAACAACCAAGAATGACCGGGGATTAC
TATTCCTGTGTTATCAGAGTAGTATCGAACGCGGGTTCAAATACATACAACAGA
GTAAGTGGCATAATCCACCGCTGTCGATAACTGACGCGTTTTCCACACTTTCTTTTAGGATATAAC
AATCCCGATTTCCCTTCGGCGAACTTGCGAGCGGATTCTCCAGGTTATGATCCTATCATGGGAACTATTCCACGATACATGACTGGCCTCAACCTCACTAAAACGAGTGAGAAACTCTCT
GTTCCTCTTCAATTTGTCGAAGCAAGGGGAGGGGAGTATTTCTTCATGCCGTCGATTTCTACTTTGGACAAGATCGCGACAGATTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAATTCTTTCTCAACCTCCTCCTACAAGGTTCATAGCTCGTATAATTCCGGCTCTCCTCAGCAGTTGGTCGAATCGATGAAATTCGGTCCCGCATCGAACCTCATACCCCGATTACTTT
CACCGTCATCCATTCGAACCACGAGCTCCTTTGCAGTTAATGTCCCTTACAAAATTAATGACAGTGACAGATCCGTAGATATAACTATACCTCCGGGATTCGACACGGAGGTGCTCTTT
A
CATTTCAGCAGAAAAGATACAAACAAGTCATTGTGGAAACTTGGCCAAATTGGAGTACCAAGAAAGAGACTTATCACGCAAACTATAATCCTAGGGAAACTGGCAAATCCGCAATGCCTG
CGCAAAAAAACCCTCAAAAGCTTAACCTCGCATTCCTCTACTTCGCCGACGGGGAGCGAACACCAGGACCCAGCAGGATGCTAAACATTTTTTCA
GAGAGTAATGCAGATACTTTCACAT
TAACT
ATCATTTCCAGGGATAAAGGCGGATCCCCACCAACTCGTCCGGCGGATAGCGATATGTATGCCAAAGTGATTCTTTATCAGTCCGACAACTTCCCACCTCCCGAAATCGACGAAC
AAGAAAAACCCAGGGGGCAAATAAAGGACCAGGCCGACGAGCAGAACACTAAGCCCAATAATGAGGACGAAGCTCCGGATTTGGGCAACATTCAAGCTGAAATAGT
ACCTGGTCTCAATA
AGGCATTCGAGTACTTCCTCTTTTTCAGAATCGAAAATGTCACCGGATTTCGAGATACGATGAAGGCCAAAATGATACCTAGAATTTCTACCGCTATGCTGGTCTTCGATATGCTCAAGA
AGAAGCAATTTCCTGCGAATGGTCTGCCGAAAGAGGATTGGGAATACGTTGGATGCAGTGTTGGATTCTCGGCTATAGGCCTTGCCAAACTTGGTTTGACGGACTATCTATATGATGAGG
CGTTCCAGCGCGGCCAGCGACGAGATGCAAAAGACTTGGGTGACAAAGGGACCGAGTCTGAGGGTGACTTCCAGGTAGAATGGGATGCCGAATTCCTCGGGGAGATACACGGAGTCTTCC
AAATCACCGCTCATAATGACAGCAAGGGCAAAGCTTTCGTTCGCCAATTGAAGAAGGACTTTGGGTATTCTAGGGGCATCCAAGTGATACAATCTATCTCTACAAAATTCCGGCCAATGC
CGCACACCAGAATGGAGCACTTTGGCTTCCGGGACGGGATCTCGAAGCCAGAGATCAAAGGTTATACATTCGATGACGAGCTTCCAATTCGTTTCCCTGGATCCCCCATTGTTGAGCCTG
GATGCCTGCTGATGGGCCGAAAGGGAGACTTGGAGAAGGACAGGCGACCTGCCTGGGCCGTTGATGGCTCGTTCTTTGTGTTTAGGAAGCTCAAGCAATATGTCCCAGAATTCCACAATT
TCCTGCGACAGAATGGGACCAGGCTATATCCAGATTTGAAGCCCGATGATGCTTCCCATAAGTTAGGAGCCAGGATGTTTGGACGTTGGAAGAGCG
GGACACCCGTCGTCCTCTCCCCCG
ATCGAGACGACGAATCCATCTCTAATGATGATAAGCGGATTAATAACTTCCAGTACCCCGGCGACCAATCAAAGTGCCCATTCGCAGCTCATACGCAGAAATCTTATCCTCGTGGTAATC
TTCCTGGAAGCAACGATCATGT
ATTCAGACGAGCTAGTATTACTTATGGCGGGGAGCTGGACGCATCTGAAACCGAAACAACCAAGAATGACCGGGGATTACTATTCCTGTGTTATCAGA
GTAGTATCGAACGCGGGTTCAAATACATACAACAGA
GATATAACAATCCCGATTTCCCTTCGGCGAACTTGCGAGCGGATTCTCCAGGTTATGATCCTATCATGGGAACTATTCCACGAT
ACATGACTGGCCTCAACCTCACTAAAACGAGTGAGAAACTCTCTGTTCCTCTTCAATTTGTCGAAGCAAGGGGAGGGGAGTATTTCTTCATGCCGTCGATTTCTACTTTGGACAAGATCG
CGACAGATTCTTGA

Retrieve as FASTA