Entry information : BaDyPrx01
Entry ID 10222
Creation 2012-01-31 (Christophe Dunand)
Last sequence changes 2012-01-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Christophe Dunand)
Peroxidase information: BaDyPrx01
Name BaDyPrx01
Class DyP-type peroxidase C    [Orthogroup: DyPrxC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx01
start..stop
S start..stop
BaDyPrx06 781 0 1..496 1..497
BaDyPrx02 741 0 1..496 1..494
BaDyPrx04 707 0 20..497 1..479
TcuDyPrx01 706 0 1..496 1..497
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 144538..144649 112 N° 2 144705..144807 103 N° 3 144859..145192 334 N° 4 145238..145352 115
N° 5 145405..145977 573 N° 6 146035..146101 67 N° 7 146153..146342 190  
join(144538..144649,144705..144807,144859..145192,145238..145352,145405..145977, 146035..146101,146153..146342)


exon

Literature and cross-references BaDyPrx01
DNA ref. JGI genome:   scaffold_45 (144538..146342)
Cluster/Prediction ref. JGI gene:   122562
Protein sequence: BaDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   498 (481)
PWM (Da):   %s   53745.45 (51837.4) Transmb domain:   %s   i5-27o
PI (pH):   %s   6.8 (6.75) Peptide Signal:   %s   cut: 17 range:17-497
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLPLLVAWVFAFVGASIHVAATSLIERQSRTAPLLGAFPGQAPLPTLAQILGLNVTNGTYLPLENIQGDILVGMRKQKERFVFFHVNDATQFKKSLQAYIPARITSCATLISSPDRQPLAFVNLAFSNAGLTALGIKDDLYDARFTSGMFADAQNLGDDLSQWAAPFTGTTIHGVFLIGSDQNLLLDQYTSDITSFFGTSITQVKVLSGSSRPGTNSGHEHFGYLDGISQPAITGWAIDTLPGQAVVPTGVILTGRFGDPIPRPVWAIDGTFMAFRHLQQKVPEFHAYTVANAIRASPAGFLTPQQGAELLGARMFGRWKSGAPLDLAPTRDDPALGADHMRNNNFAYVDGVLDQTECPFGAHVRKTNPRADFPGLEVINHAVRSSIPYGPETSSAELASGVSSQDRGLLFAEYQSVIDNGFRFQQVAWANNPLFPPKPRTAGIDPIIGQGTPRSMGGLDPLYQSKMYTLPQFVIPKGGEYFFMPSISALMTHIAR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACCTTCCCCTACTTGTCGCGTGGGTGTTCGCGTTCGTTGGTGCAAGTATTCATGTTGCTGCCACCAGTCTCATCGAGAGACAGTCGCGTACTGCACCGCTGCTTGGTGGTACGTCA
GCTGTGCGTCCGTTCGGTTAATCCAAACCTGATCGCATATCGTTCAGCGTTTCCCGGGCAAGCTCCCCTGCCCACCCTTGCGCAGATCCTGGGATTGAACGTGACGAACGGGACATATCT
GCCGCTAGAGAACATTCAAGGAGACATTTT
GTACGTCGCCTCCTCCCCTCGCGTTCAATCCTGTCGCTAACGCTCACCAAGGGTCGGAATGAGGAAACAAAAAGAACGCTTCGTCTTTTT
TCACGTCAACGATGCGACGCAGTTCAAGAAGTCGCTACAGGCCTACATCCCAGCGCGCATCACATCGTGTGCGACGCTCATATCGTCCCCTGACCGACAACCACTCGCGTTCGTCAACCT
TGCTTTCTCGAATGCGGGGCTCACGGCGCTTGGAATCAAGGACGACCTCTACGACGCACGATTTACCTCTGGAATGTTTGCGGACGCGCAAAACCTTGGGGACGATCTCAGCCAATGGGC
GGCACCTTTTACTGGGACTACTATCCATGGTGTATTTCTGATAGGGAGCGACCAG
GTGAGTGTGATTAGGACTCGTCGAGGATCGTGCTCACGATCGTAGAATTTGTTATTGGACCAATA
CACGAGCGACATTACCTCGTTTTTCGGAACCTCCATTACACAGGTCAAAGTGCTGAGCGGATCCTCCCGTCCTGGAACCAATTCTGGACACGAAC
GTAAGTCGTCAACTCTCCTCCGCGA
GAGGTAGCGATCTGACACCTCGAACAGACTTTGGCTACCTCGACGGGATCTCCCAACCAGCCATCACAGGTTGGGCGATCGACACCCTCCCAGGCCAAGCGGTCGTGCCCACAGGCGTCA
TCCTCACCGGACGCTTCGGCGACCCAATACCCCGCCCAGTATGGGCTATCGACGGCACCTTCATGGCATTCCGGCACCTTCAGCAGAAGGTCCCCGAGTTTCATGCCTACACGGTCGCCA
ACGCCATACGCGCGAGCCCTGCAGGGTTCCTCACGCCGCAGCAAGGCGCAGAGCTCCTCGGCGCGCGGATGTTCGGACGTTGGAAGAGCGGTGCACCACTGGACCTTGCGCCGACGCGCG
ACGACCCTGCACTCGGCGCGGACCACATGCGTAATAACAACTTCGCGTATGTGGATGGGGTGTTGGACCAAACGGAGTGTCCGTTCGGTGCGCACGTACGCAAGACGAACCCGCGCGCGG
ACTTTCCTGGTCTTGAGGTCATCAACCACGCGGTGAGGTCCAGCATTCCATACGGCCCCGAGACGTCTAGCGCAGAGCTCGCGTCTGGGGTAAGCTCCCAAGATCGCGGTCTTCTCTTCG
GTACGTCCACCCCGTTTTCTAAGAGCTTCTCGAACACTGACCTGATGTTTGGCACAGCGGAGTACCAGTCCGTCATCGACAATGGGTTCAGGTTCCAGCAGGTCGCCTGGGCCAACAATC
CGCT
GTGAGTATCCTCATGACACTGTGTTCAGTCCCGATGCTCATACGTCCGTAGCTTCCCTCCCAAGCCACGCACCGCGGGTATCGACCCTATCATCGGCCAAGGCACACCACGCAGCA
TGGGCGGGCTCGATCCCCTCTACCAGTCGAAGATGTACACACTTCCACAGTTTGTGATCCCGAAGGGCGGCGAATACTTCTTCATGCCCTCTATTTCTGCACTCATGACGCATATTGCTC
GTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACCTTCCCCTACTTGTCGCGTGGGTGTTCGCGTTCGTTGGTGCAAGTATTCATGTTGCTGCCACCAGTCTCATCGAGAGACAGTCGCGTACTGCACCGCTGCTTGGTGCGTTTCCC
GGGCAAGCTCCCCTGCCCACCCTTGCGCAGATCCTGGGATTGAACGTGACGAACGGGACATATCTGCCGCTAGAGAACATTCAAGGAGACATTTT
GGTCGGAATGAGGAAACAAAAAGAA
CGCTTCGTCTTTTTTCACGTCAACGATGCGACGCAGTTCAAGAAGTCGCTACAGGCCTACATCCCAGCGCGCATCACATCGTGTGCGACGCTCATATCGTCCCCTGACCGACAACCACTC
GCGTTCGTCAACCTTGCTTTCTCGAATGCGGGGCTCACGGCGCTTGGAATCAAGGACGACCTCTACGACGCACGATTTACCTCTGGAATGTTTGCGGACGCGCAAAACCTTGGGGACGAT
CTCAGCCAATGGGCGGCACCTTTTACTGGGACTACTATCCATGGTGTATTTCTGATAGGGAGCGACCAG
AATTTGTTATTGGACCAATACACGAGCGACATTACCTCGTTTTTCGGAACC
TCCATTACACAGGTCAAAGTGCTGAGCGGATCCTCCCGTCCTGGAACCAATTCTGGACACGAAC
ACTTTGGCTACCTCGACGGGATCTCCCAACCAGCCATCACAGGTTGGGCGATCGAC
ACCCTCCCAGGCCAAGCGGTCGTGCCCACAGGCGTCATCCTCACCGGACGCTTCGGCGACCCAATACCCCGCCCAGTATGGGCTATCGACGGCACCTTCATGGCATTCCGGCACCTTCAG
CAGAAGGTCCCCGAGTTTCATGCCTACACGGTCGCCAACGCCATACGCGCGAGCCCTGCAGGGTTCCTCACGCCGCAGCAAGGCGCAGAGCTCCTCGGCGCGCGGATGTTCGGACGTTGG
AAGAGCGGTGCACCACTGGACCTTGCGCCGACGCGCGACGACCCTGCACTCGGCGCGGACCACATGCGTAATAACAACTTCGCGTATGTGGATGGGGTGTTGGACCAAACGGAGTGTCCG
TTCGGTGCGCACGTACGCAAGACGAACCCGCGCGCGGACTTTCCTGGTCTTGAGGTCATCAACCACGCGGTGAGGTCCAGCATTCCATACGGCCCCGAGACGTCTAGCGCAGAGCTCGCG
TCTGGGGTAAGCTCCCAAGATCGCGGTCTTCTCTTCG
CGGAGTACCAGTCCGTCATCGACAATGGGTTCAGGTTCCAGCAGGTCGCCTGGGCCAACAATCCGCTCTTCCCTCCCAAGCCA
CGCACCGCGGGTATCGACCCTATCATCGGCCAAGGCACACCACGCAGCATGGGCGGGCTCGATCCCCTCTACCAGTCGAAGATGTACACACTTCCACAGTTTGTGATCCCGAAGGGCGGC
GAATACTTCTTCATGCCCTCTATTTCTGCACTCATGACGCATATTGCTCGTTGA

Retrieve as FASTA