Entry information : BaDyPrx05
Entry ID 10226
Creation 2012-01-31 (Christophe Dunand)
Last sequence changes 2012-01-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaDyPrx05
Name BaDyPrx05
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx05
start..stop
S start..stop
BaDyPrx02 717 0 1..498 1..494
BaDyPrx06 671 0 1..499 1..498
BaDyPrx01 658 0 1..498 1..496
BaDyPrx03 654 0 1..499 1..498
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 137199..137310 112 N° 2 137367..137469 103 N° 3 137525..137858 334 N° 4 137906..138020 115
N° 5 138076..138651 576 N° 6 138707..138773 67 N° 7 138821..139013 193  
join(137199..137310,137367..137469,137525..137858,137906..138020,138076..138651, 138707..138773,138821..139013)


exon

Literature and cross-references BaDyPrx05
DNA ref. JGI genome:   scaffold_20 (137199..139013)
Cluster/Prediction ref. JGI gene:   184878
Protein sequence: BaDyPrx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   499 (479)
PWM (Da):   %s   53643.58 (51522.5)  
PI (pH):   %s   7.55 (7.31) Peptide Signal:   %s   cut: 21 range:21-499
Sequence 541
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLLPLVASTFAFAVASTSAVASDLSGAHTRTKPLLVAAPGHAAIPTLSQIQTANATNGTFLPLENIQGDILVGLGKQRARYVFFHVKHVAQFKSALKNFIPTHITSTATLISHPIRQPHAFVNLAFSSTGLKALGVVGDLRDPYFAAGQFADAESLGDNLDLWASPFNGTTIHGVFVIGSDQDTHLSRCIDDISVVFKSSITQLLALNGSVRPGNQTGHEHFGFLDGISQPAVLGFVTKPLPGQEVVPPGTILTGRAGDRTVRPPWALDGSFMAFRHFEQKVPEFHAWTRANAIRRTSAGNLSQEQGAELLGARMFGRWKSGAPLDLAPTHDDPELGADPQRNNDFSYADTLLDQARCPFSAHARKTNPRADVTLDRSIMNHAIRASIPYGPETSPAELASGVSAQDRGLLFAEYQSDIGNGFRSQQIKWANDPKFPPRKPDVPGVEPIVGQGSPRLVGGLDPLDQSKMYEIPQFVIPKGGEYFFMPSIPALASVIAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGCCTCCTGCCGCTTGTCGCGTCAACGTTTGCGTTCGCAGTTGCGAGCACGTCTGCGGTTGCTTCTGACCTCAGCGGGGCACACACTCGTACTAAACCTCTTCTAGTTGGTACGTACG
TCAGTTCTCCGCGCGTATTGAGTTCGTACTGACTCCGTCTCTTCTAGCGGCCCCGGGGCACGCCGCGATACCCACACTGTCGCAGATTCAGACTGCGAACGCGACGAACGGAACGTTTCT
GCCATTAGAGAACATTCAAGGGGACATTCT
GTACGTCACGTCTCTTAAGCTGTTACCCCAGAGTTCGTTGCTGATGGTCGTGAAGAGTTGGATTAGGGAAACAGAGAGCACGCTACGTGT
TTTTCCACGTCAAACATGTGGCACAGTTCAAGTCCGCGCTGAAGAACTTTATACCGACACACATCACCTCGACCGCAACGCTAATTTCACATCCTATTCGACAGCCACACGCATTTGTAA
ACCTCGCGTTCTCGAGCACAGGGCTCAAGGCCCTTGGAGTTGTCGGCGACCTCCGTGACCCATACTTCGCCGCTGGCCAGTTCGCAGACGCCGAAAGCCTTGGGGACAATCTCGATCTAT
GGGCGTCGCCGTTTAATGGTACGACTATTCATGGGGTCTTTGTAATTGGAAGCGATCAA
GTGAGTAAGGTTAGACTGTGTGGCGAATTAAATTGACTTCAAGGCAGGATACGCACCTAAG
TCGGTGCATCGATGACATCTCTGTGGTTTTCAAAAGCTCCATCACTCAGTTATTAGCACTGAACGGGTCTGTGCGGCCTGGCAACCAAACAGGACATGAAC
GTGAGCTGTCAACTCTCCG
CTGCGAAGTGCTATTATCTGACACCGTAGTGGGTAGACTTTGGTTTCCTCGACGGCATCTCGCAGCCAGCAGTCTTGGGCTTCGTAACAAAACCACTTCCCGGCCAAGAAGTCGTGCCAC
CAGGAACGATCCTCACAGGACGCGCGGGCGACCGGACAGTACGTCCTCCATGGGCTCTCGACGGAAGCTTTATGGCATTCCGGCACTTCGAGCAGAAGGTCCCCGAATTCCACGCCTGGA
CGCGCGCAAACGCCATACGGAGGACCAGTGCGGGGAACCTCTCGCAGGAGCAGGGTGCAGAGTTACTCGGCGCGCGCATGTTCGGTCGTTGGAAGAGTGGTGCGCCGCTGGACCTCGCGC
CAACGCACGACGACCCGGAGCTCGGTGCGGACCCGCAGAGGAACAACGATTTCAGCTATGCGGATACGCTGTTGGACCAGGCGCGGTGCCCGTTTAGCGCACACGCGAGGAAGACGAATC
CACGCGCCGACGTAACACTCGACCGCTCGATTATGAATCACGCTATACGAGCGAGTATTCCGTATGGCCCGGAGACGTCTCCTGCAGAGCTGGCGTCGGGTGTAAGTGCTCAAGATCGCG
GGCTTCTCTTTG
GTATGTCCATTCATTGTCGATCCCTCCTTGATGGTTCACTGAATCTACGGCGCAGCCGAATATCAATCCGACATCGGCAACGGGTTCAGGTCACAACAAATCAAATGG
GCCAATGATCCAAA
GTCTGTCTCTTCATATCTCGTCCCAACGGTTGCTGATCTTCCAGTAGATTCCCACCTCGCAAACCAGACGTACCCGGAGTTGAACCTATCGTTGGCCAAGGATCTC
CACGTTTGGTCGGCGGCCTCGATCCCCTTGACCAGTCGAAGATGTACGAAATTCCACAATTTGTGATCCCAAAGGGTGGAGAATATTTCTTCATGCCATCTATTCCCGCACTCGCTTCCG
TCATCGCTAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGCCTCCTGCCGCTTGTCGCGTCAACGTTTGCGTTCGCAGTTGCGAGCACGTCTGCGGTTGCTTCTGACCTCAGCGGGGCACACACTCGTACTAAACCTCTTCTAGTTGCGGCCCCGG
GGCACGCCGCGATACCCACACTGTCGCAGATTCAGACTGCGAACGCGACGAACGGAACGTTTCTGCCATTAGAGAACATTCAAGGGGACATTCT
AGTTGGATTAGGGAAACAGAGAGCAC
GCTACGTGTTTTTCCACGTCAAACATGTGGCACAGTTCAAGTCCGCGCTGAAGAACTTTATACCGACACACATCACCTCGACCGCAACGCTAATTTCACATCCTATTCGACAGCCACACG
CATTTGTAAACCTCGCGTTCTCGAGCACAGGGCTCAAGGCCCTTGGAGTTGTCGGCGACCTCCGTGACCCATACTTCGCCGCTGGCCAGTTCGCAGACGCCGAAAGCCTTGGGGACAATC
TCGATCTATGGGCGTCGCCGTTTAATGGTACGACTATTCATGGGGTCTTTGTAATTGGAAGCGATCAA
GATACGCACCTAAGTCGGTGCATCGATGACATCTCTGTGGTTTTCAAAAGCT
CCATCACTCAGTTATTAGCACTGAACGGGTCTGTGCGGCCTGGCAACCAAACAGGACATGAAC
ACTTTGGTTTCCTCGACGGCATCTCGCAGCCAGCAGTCTTGGGCTTCGTAACAAAAC
CACTTCCCGGCCAAGAAGTCGTGCCACCAGGAACGATCCTCACAGGACGCGCGGGCGACCGGACAGTACGTCCTCCATGGGCTCTCGACGGAAGCTTTATGGCATTCCGGCACTTCGAGC
AGAAGGTCCCCGAATTCCACGCCTGGACGCGCGCAAACGCCATACGGAGGACCAGTGCGGGGAACCTCTCGCAGGAGCAGGGTGCAGAGTTACTCGGCGCGCGCATGTTCGGTCGTTGGA
AGAGTGGTGCGCCGCTGGACCTCGCGCCAACGCACGACGACCCGGAGCTCGGTGCGGACCCGCAGAGGAACAACGATTTCAGCTATGCGGATACGCTGTTGGACCAGGCGCGGTGCCCGT
TTAGCGCACACGCGAGGAAGACGAATCCACGCGCCGACGTAACACTCGACCGCTCGATTATGAATCACGCTATACGAGCGAGTATTCCGTATGGCCCGGAGACGTCTCCTGCAGAGCTGG
CGTCGGGTGTAAGTGCTCAAGATCGCGGGCTTCTCTTTG
CCGAATATCAATCCGACATCGGCAACGGGTTCAGGTCACAACAAATCAAATGGGCCAATGATCCAAAATTCCCACCTCGCA
AACCAGACGTACCCGGAGTTGAACCTATCGTTGGCCAAGGATCTCCACGTTTGGTCGGCGGCCTCGATCCCCTTGACCAGTCGAAGATGTACGAAATTCCACAATTTGTGATCCCAAAGG
GTGGAGAATATTTCTTCATGCCATCTATTCCCGCACTCGCTTCCGTCATCGCTAGTTGA

Retrieve as FASTA