Entry information : EcamAPx03 (EcC013874.30)
Entry ID 10237
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-02-11 (Qiang Li)
Peroxidase information: EcamAPx03 (EcC013874.30)
Name (synonym) EcamAPx03 (EcC013874.30)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamAPx03
start..stop
S start..stop
EgrAPx03 498 0 1..245 1..245
EglAPx03 488 2e-178 1..245 1..245
CchuAPx02 469 1e-170 1..245 1..245
QshAPx01 468 2e-170 1..245 1..245
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..119 119 N° 2 223..397 175 N° 3 555..620 66 N° 4 1085..1133 49
N° 5 1215..1297 83 N° 6 1406..1485 80 N° 7 1614..1716 103 N° 8 1816..1878 63
join(1..119,223..397,555..620,1085..1133,1215..1297,1406..1485,1614..1716,1816.. 1878)


exon

Literature and cross-references EcamAPx03 (EcC013874.30)
Protein sequence: EcamAPx03 (EcC013874.30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   245
PWM (Da):   %s   26711.54  
PI (pH):   %s   5.37
Sequence 286
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKCYPTVSEEYSKAVEKCKKKLRGLIAEKNCAPLMLRLAWHSAGTYDVKTKTGGPFGTMKLAAELAHGANNGLDIAVRLLEPIKEQFPVLSYADFYQLAGVVAVEVTGGPEIPFHPGREDKPEPPPEGRLPDATKGSDHLRDVFGHMGLSDQDIVALSGGHTLGRCHKERSGFEGPWTTNPLIFDNTYFTELLTGDKEGLLQLPSDKALLTDPVFRPLVEKYAADEDAFFADYAEAHLKLSELG

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGGAAGTGTTATCCGACCGTGAGCGAGGAGTACAGCAAGGCCGTCGAGAAATGCAAGAAGAAGCTCCGAGGCCTCATCGCCGAGAAGAACTGCGCTCCGCTCATGCTTCGTCTCGCGT
ACCTCTCTCTCTCTCTCTCTCTCTCTTAGACCCAAAGTTCATTTACGATCGACTGAAGTTTCGGTCATGTGAATCGACCTTGCCGTGTGCTGTCGCTGCAGATGGCACTCTGCCGGTACC
TACGACGTGAAGACGAAGACAGGGGGTCCGTTTGGGACCATGAAGCTTGCCGCTGAGCTCGCTCATGGCGCCAATAACGGTCTCGACATAGCCGTGAGGCTGTTGGAGCCCATCAAGGAG
CAGTTTCCTGTCCTCTCTTACGCCGACTTCTATCAG
GTGAGACTACTTGCGGCCCGCAGCTGAAGGCGCTGCCTAGATCTGGACATGATACTTCCGTCTTGGGTTTTTCGAAGTCCGATG
CTGTGCCGGCTCGGAATCATGTACGTACTAATGATTGTTTTGGTTAGACTGATTATGTCCTGATGCGTCGCAGTTGGCTGGTGTTGTCGCCGTGGAAGTCACCGGCGGACCTGAAATTCC
GTTCCACCCGGGAAGAGAG
GTCAGTGGATTTTTTTTTTTTGGGTGCTGTCTTGATTAGCTTGATGTCCTGGGGATGCTGGCGCTGTGAAGTTCTTGATTCCAATTGACTGTCTTTTTCAC
AATTAAATTGTTAGGCGGCTTGGAGGCTTACTCGGGTTTTAGAAGTCTAAGATTAAGTCTTCTTTTTGAGGGCTTGCTTGTTTTCTAAGAACAGATTATGTCTGTGTGGACTGATGTATC
GAAGATAGGTTAATATAAGCTTCGGAGTTTGAATGTCATGCACTTTTCCTTGTGATGCTAGGCAATGTCGTGACACATTATCTTGTTCTTTATCTCACCTGCCTCCCCTGTGCCTTTTCT
GTGTCAGTACTCTTGTGCTCTGCCTTTTATCCGACCAGTTTTCCCTGTAAAATGTTTTGCCAATGATTGATGATTGAATCCTAGTTCATGTTGTGATGATGGTGTTGTCATCTTAAACCA
CAGGATAAGCCGGAACCGCCTCCTGAGGGTCGTCTTCCTGATGCCACCAAGGGTTAGTTCGTCTTCCCTGCTTTAAAGAGCAAATCTCCATGTGAGCGTTGCATTTTGCATGACAAATGC
CTGATCTCCGCAGGCTCTGATCATTTGAGAGATGTGTTTGGTCACATGGGTTTGAGCGATCAGGATATTGTTGCTCTCTCTGGTGGCCATACCCTGGTTTGTATTTCAATTCTCTGGAAC
TTGGACTTCCGGTGCTTTCCACAAATTAAAGCAGCGTAGTGAATTCTGACTTCATGTACTCATTTTTCCTTTCGCTTCATCCAGGGAAGATGCCACAAAGAAAGATCTGGATTTGAGGGA
CCTTGGACTACCAATCCTCTCATTTTTGATAACACCTATTTCAC
GTGAGTTTCCTGGATTTATTTGTGCCGCGAATGGATTTGTATGCCTGATGTGGAAGTATTTTATTGCACTACGACA
CGGTAGGACCTGGATAGCACTCCGAGTAAAAAGTGGCTTTTTTTTTTCTTAGGGAGCTATTGACCGGTGATAAGGAAGGTCTCCTTCAGCTGCCATCCGACAAGGCTCTTCTCACTGATC
CCGTTTTCCGTCCACTTGTTGAAAAATACGCTGCG
GTGCGTACTTTCTCTTGTTGGCTGCTTTGATACAGTTCCTTTCAATCGGCAACTGCATCTACATATGCACTCTGTTTGAACATTG
TTTTGCTCTTCCAGGATGAAGATGCCTTCTTCGCTGACTATGCGGAAGCTCACCTAAAACTCTCTGAACTTGGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGGAAGTGTTATCCGACCGTGAGCGAGGAGTACAGCAAGGCCGTCGAGAAATGCAAGAAGAAGCTCCGAGGCCTCATCGCCGAGAAGAACTGCGCTCCGCTCATGCTTCGTCTCGCAT
GGCACTCTGCCGGTACCTACGACGTGAAGACGAAGACAGGGGGTCCGTTTGGGACCATGAAGCTTGCCGCTGAGCTCGCTCATGGCGCCAATAACGGTCTCGACATAGCCGTGAGGCTGT
TGGAGCCCATCAAGGAGCAGTTTCCTGTCCTCTCTTACGCCGACTTCTATCAG
TTGGCTGGTGTTGTCGCCGTGGAAGTCACCGGCGGACCTGAAATTCCGTTCCACCCGGGAAGAGAGG
ATAAGCCGGAACCGCCTCCTGAGGGTCGTCTTCCTGATGCCACCAAGG
GCTCTGATCATTTGAGAGATGTGTTTGGTCACATGGGTTTGAGCGATCAGGATATTGTTGCTCTCTCTGGTG
GCCATACCCTG
GGAAGATGCCACAAAGAAAGATCTGGATTTGAGGGACCTTGGACTACCAATCCTCTCATTTTTGATAACACCTATTTCACGGAGCTATTGACCGGTGATAAGGAAGGTC
TCCTTCAGCTGCCATCCGACAAGGCTCTTCTCACTGATCCCGTTTTCCGTCCACTTGTTGAAAAATACGCTGCG
GATGAAGATGCCTTCTTCGCTGACTATGCGGAAGCTCACCTAAAAC
TCTCTGAACTTGGGTAA

Retrieve as FASTA