Entry information : EcamPrx51 (EcC002968.20)
Entry ID 10269
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx51 (EcC002968.20)
Name (synonym) EcamPrx51 (EcC002968.20)
Class Class III peroxidase    [Orthogroup: Prx065]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx51
start..stop
S start..stop
EgrPrx51 675 0 1..334 1..334
EglPrx51 645 0 1..334 1..333
EguPrx51 627 0 1..334 1..334
EgrPrx53 627 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 361..552 192 N° 3 679..844 166 N° 4 2330..2745 416
join(1..228,361..552,679..844,2330..2745)


exon

Literature and cross-references EcamPrx51 (EcC002968.20)
Protein sequence: EcamPrx51 (EcC002968.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   35671.83 (32720.2)  
PI (pH):   %s   6.49 (5.93) Peptide Signal:   %s   cut: 30 range:30-334
Sequence 375
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSSTLSSPTVVALSAAALLFLLRPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSILLDNSPTIKSEKDSAPSFKSARGFGVVDKIKAAIESTCPGTVSCADILALAANASVYLSGGPYWTVLLGRRDGLTANQGLANTSIPSPFDSYANLTSKFFAVGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTADGGPDPTLSPWYLTALQKLCPPNFSSSVLADLDPTTPNLFDNHYYSNLQKNDGLFQSDQELYSTAGAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRCNCRKVNES

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTCTGCCGCCGCATTGTTGTTTCTCCTCCGTCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGCC
CGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGTCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAG
GTGAGTCCCTACA
ATAGATCAATTCCCACTGACAATGAGTCCCAACTTACCGCATTCTTTTTACGGTACTTTCGATCTGATTATTGAGTTATTAGCCACGTAACCTAATGCTTGAGAATGACATGTTTAAAGG
GGTGTGATGGATCGATATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATTCCGCTCCGAGTTTTAAGTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTG
AGAGCACTTGTCCTGGGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
GTATATGTTGTTTTAGTCAAAGAAATATAAAACATATTTAAAGTATACT
TAGGATTCGTTATTGTTACTTGGCCTACACGAATTACAATTGTGTTTCTCTTGATTATCACTTCTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACG
GCTTGACCGCGAACCAAGGGCTAGCGAACACATCGATACCCTCCCCTTTTGATAGCTATGCCAACCTCACTTCCAAGTTCTTTGCTGTGGGCTTGGACATCACCGACCTTGTCACACTTT
CCG
GTAAAATAGAACAGTTGGACTTGCATTTTGATACGAAACGGGCAACTACAGATATTTATGCACACAATAGATTAACAGAGTGAAATGTTAGGTTTTTGTCACATAACTTATCGGCAC
AAACATTGCGTCACTTTCAGTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACTGACGGGCATTGGCTGTGCATGTGCATGGGCCGTGCCCGCACAGC
CCATGCCCCGGCAATGCTATCTACTAGAAGGAATTTTAGTTAAGGGTTAAGGTTTACTTTATTTATCTAAAATTGAATAAGTAAAGAATTGTCCTAAAACATGAGATCGACTAAAGTGCA
TGTGTTGTGCCTAGGCTGTTCATGGGTCGCGCATGGGCTATGCACATTTACTAGAAGGAGTTTTGGCTGAGGATTAATGATTTATTTTTTACCAAAAATTGAAAAAGTAAAGGATTGCCC
TTGACTTGAGATCGACTGACGTGCATTCGTTGTGCCTGGGCCATGCCATGTTGTGCATGGGTATGTAAATATATTAGAAGGAATTTTGGCTAAAGAATTAAGGGTTTCTTTTTTTTTGCC
AAAAATTGAAAAAGTAAAGGATTGCCCTCGACTTAATTTCAGGAGCAGTTGTGTATCATCACTACTCTAAAAAAGATAGATTATTTAAAAACAATTTTTTGCATGACCGAGACTTATCTA
CTCGGTAAATTCAAAAATGAGAGGAAGCCAATGATACGTAATTTCTTTAAATTAGAAATTATGGGTTCATCCATTTGCAGGTCCATAATTTGCTAGTCCTAGATAGAAATGGTAATTCAT
ATAGGGTTAGTTTGATTGAACTGAATAAGTGAAGTTAAAATCCCCTTGCGTGGATCCCACTTATCTTTAATTCAAATGGATCTAAACCAAGCCCGTATTAGCGACTCTTAGGTCTTATCT
AGTATAACTTCTGATATCAAGATGAAGAAGTGGTCAACAATGACACTTCATCGTTCAATTCATGACGAGGTTCATAGCGCTGAAACCATCGAATTAATGTAGTATTTTCTTTGTTGTGAT
TTGTTTTCAATCAAACTAGTGTACTTTTATGTGTAACTTTTTTTTATTACAAATTTGAAAAATATATGCATGTTTTATTCATTTTTTCAATGGGTAATTTTATATTCCTGATATCATTAC
AGGAGTATAAATATCGGGGGAGGATGCTATCAAAATTTGCAAGCCCCTCATATACTTGTATGAGAAATGCCAAGTATACTGGGGTCATTTGATAAGTTCAATAAATTAATTGATGTCACA
GATCATTATTATTTATTTATATTTTTACTAACGAGTTTGTTGCTTATGTTTAGTATACAAATTCTATTAAGCATTCCTAGTATTGGTCTATTTATCCACCTTCACAATTGAGCATCTGCG
GATATTTTGTTCTCTTAGCTAATTATTCGAGCATATGATAATAAACAGGAGCTCACACCTTTGGACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCGCAGATGGTG
GCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACTTCAGTAGTAGCGTCCTTGCCGACCTCGACCCGACGACCCCGAACTTGTTTGACAACC
ACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTCAGTCTGATCAAGAGCTGTACTCGACAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCT
TCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATCAGTCCTCTCACCGGAAGTAACGGGGAGATCAGGTGCAATTGTAGGAAGGTCAATGAGAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCCGTTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTCTGCCGCCGCATTGTTGTTTCTCCTCCGTCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGCC
CGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGTCTCCTCCGTCTCCATTTCCACGATTGCTTCGTCCAG
GGGTGTGATGGAT
CGATATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATTCCGCTCCGAGTTTTAAGTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGTC
CTGGGACTGTGTCTTGCGCTGACATCCTCGCCTTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACGGCTTGACCGCGAACCAAG
GGCTAGCGAACACATCGATACCCTCCCCTTTTGATAGCTATGCCAACCTCACTTCCAAGTTCTTTGCTGTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACCTTTG
GACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCGCAGATGGTGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACT
TCAGTAGTAGCGTCCTTGCCGACCTCGACCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTCAGTCTGATCAAGAGCTGTACTCGA
CAGCCGGTGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATCAGTCCTCTCACCGGAAGTA
ACGGGGAGATCAGGTGCAATTGTAGGAAGGTCAATGAGAGT

Retrieve as FASTA