Entry information : OsPrx18(LOC_Os01g51550)
Entry ID 1028
Creation 2005-07-20 (Filippo Passardi)
Last sequence changes 2005-07-20 (Filippo Passardi)
Sequence status complete
Reviewer Catherine
Last annotation changes 2022-02-18 (Catherine )
Peroxidase information: OsPrx18(LOC_Os01g51550)
Name OsPrx18(LOC_Os01g51550)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx18
start..stop
S start..stop
SiPrx22 561 0 1..366 1..365
BdiPrx93 521 0 2..364 3..358
SbPrx78 489 2e-174 12..365 15..387
ZmPrx100 477 8e-170 30..365 37..378
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29604201..29604527 327 N° 2 29604634..29604988 355 N° 3 29605071..29605489 419  
join(29604201..29604527,29604634..29604988,29605071..29605489)


exon

Literature and cross-references OsPrx18(LOC_Os01g51550)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1S5
DNA ref. GenBank:   NC_008394.1 (29604201..29605486)
Protein sequence: OsPrx18(LOC_Os01g51550)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (338)
PWM (Da):   %s   39325.56 (36414.0)  
PI (pH):   %s   5.69 (5.27) Peptide Signal:   %s   cut: 29 range:29-366
Sequence 407
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRPDPATGLRFAAVSLILCTANICAVARRSSYALLLDDEEDGGGGGDGSASFSFFPQTQPRGLVYGFYDESCPDAEGIVSSTVRELYLANPNVAAALVRLFFHDCFIHGCDASVLLDRINGDKSEREAAPNQSLRGFGAVDKIKARLEAACPRTVSCADILVLAARDSLVLAGGPSYPVLTGRSDSARAFYDEVGARIPSPNATYTVTLDAFARRGFTERETVALLGAHSIGKVHCRFFKDRIDNFAGTGEPDDTIDADMVEEMRAVCDGDGAAPMEMGYYRQGREVGFGAHYYAKLLGGRGILRSDQQLTAGSTVRWVRVYAAGERGEEVFREDFAHAMVKLAALEPLTGSPGHVRIRCSKPVE

Retrieve as FASTA  
Remarks chromosome 1; no EST found (NIAS DNA database and TIGR)
Predicted sequence in Phytozome LOC_Os01g51550 is too long (608 aa)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGACGGCCTGATCCGGCGACTGGCTTGCGCTTTGCGGCCGTCTCGCTGATCCTGTGCACGGCCAACATCTGTGCGGTGGCCAGACGGTCGTCGTACGCGCTCCTGCTCGACGACGAGG
AGGACGGCGGCGGAGGCGGTGACGGCTCGGCGTCCTTCTCCTTCTTCCCGCAGACGCAGCCGCGCGGGCTGGTGTACGGGTTCTACGACGAGAGTTGCCCCGACGCCGAGGGGATCGTGT
CGTCCACCGTGCGGGAGCTCTACCTCGCCAACCCCAACGTCGCCGCCGCGCTCGTCCGCCTCTTCTTCCACGACTGCTTCATCCAC
GTACGCGTGCTCCGCGCGTCGCGTCTCATTCACA
GTCATGCTGTCCTTTCTACACTCGCACGCTTGACACAACCAAGGTGTTCCCTTCCCCGTGACGCGCGTGCAGGGCTGCGACGCCTCGGTGCTCCTGGACCGCATCAACGGCGACAAGTCG
GAGAGGGAAGCGGCCCCGAACCAGTCGCTGAGAGGCTTCGGCGCCGTCGACAAGATCAAGGCGAGGCTGGAGGCGGCGTGCCCGCGGACCGTCTCCTGCGCCGACATCCTGGTCCTCGCC
GCGCGGGACAGCCTCGTCCTAGCGGGCGGGCCGAGCTATCCCGTGCTCACCGGACGCAGCGACAGCGCCAGGGCCTTCTACGACGAGGTGGGCGCGCGCATCCCGTCGCCGAACGCCACC
TACACCGTGACGCTCGATGCGTTCGCCCGCCGCGGCTTCACCGAGCGCGAGACCGTCGCGCTCTTAG
GTCCGTCCCGTTCGTCCCTCCGTCTGTCCATTGGCGCTCGCGCGCATGCATAT
GCATTTGATTTTTGTTGGCGCTGTAGCAGGAGCACATAGCATCGGGAAGGTGCATTGCAGATTCTTCAAGGACAGGATCGACAACTTCGCCGGGACAGGCGAGCCTGACGACACCATCGA
CGCCGACATGGTCGAAGAGATGCGCGCGGTGTGCGACGGCGACGGCGCCGCGCCGATGGAGATGGGGTACTACCGGCAGGGGAGGGAGGTGGGTTTCGGCGCGCACTACTACGCGAAGCT
TCTCGGTGGACGGGGCATCCTGCGGTCGGACCAGCAGCTCACGGCGGGGAGTACCGTGCGGTGGGTGCGCGTGTACGCGGCCGGGGAGCGCGGCGAGGAGGTGTTCCGCGAGGACTTCGC
GCACGCAATGGTTAAGCTTGCCGCGCTTGAGCCGCTCACCGGGTCGCCCGGCCACGTCCGGATCCGCTGCTCCAAACCCGTGGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGACGGCCTGATCCGGCGACTGGCTTGCGCTTTGCGGCCGTCTCGCTGATCCTGTGCACGGCCAACATCTGTGCGGTGGCCAGACGGTCGTCGTACGCGCTCCTGCTCGACGACGAGG
AGGACGGCGGCGGAGGCGGTGACGGCTCGGCGTCCTTCTCCTTCTTCCCGCAGACGCAGCCGCGCGGGCTGGTGTACGGGTTCTACGACGAGAGTTGCCCCGACGCCGAGGGGATCGTGT
CGTCCACCGTGCGGGAGCTCTACCTCGCCAACCCCAACGTCGCCGCCGCGCTCGTCCGCCTCTTCTTCCACGACTGCTTCATCCAC
GGCTGCGACGCCTCGGTGCTCCTGGACCGCATCA
ACGGCGACAAGTCGGAGAGGGAAGCGGCCCCGAACCAGTCGCTGAGAGGCTTCGGCGCCGTCGACAAGATCAAGGCGAGGCTGGAGGCGGCGTGCCCGCGGACCGTCTCCTGCGCCGACA
TCCTGGTCCTCGCCGCGCGGGACAGCCTCGTCCTAGCGGGCGGGCCGAGCTATCCCGTGCTCACCGGACGCAGCGACAGCGCCAGGGCCTTCTACGACGAGGTGGGCGCGCGCATCCCGT
CGCCGAACGCCACCTACACCGTGACGCTCGATGCGTTCGCCCGCCGCGGCTTCACCGAGCGCGAGACCGTCGCGCTCTTAG
GAGCACATAGCATCGGGAAGGTGCATTGCAGATTCTTCA
AGGACAGGATCGACAACTTCGCCGGGACAGGCGAGCCTGACGACACCATCGACGCCGACATGGTCGAAGAGATGCGCGCGGTGTGCGACGGCGACGGCGCCGCGCCGATGGAGATGGGGT
ACTACCGGCAGGGGAGGGAGGTGGGTTTCGGCGCGCACTACTACGCGAAGCTTCTCGGTGGACGGGGCATCCTGCGGTCGGACCAGCAGCTCACGGCGGGGAGTACCGTGCGGTGGGTGC
GCGTGTACGCGGCCGGGGAGCGCGGCGAGGAGGTGTTCCGCGAGGACTTCGCGCACGCAATGGTTAAGCTTGCCGCGCTTGAGCCGCTCACCGGGTCGCCCGGCCACGTCCGGATCCGCT
GCTCCAAACCCGTGGAGTAG

Retrieve as FASTA