Entry information : EcamPrx66-1 (EcC051478.60)
Entry ID 10299
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx66-1 (EcC051478.60)
Name (synonym) EcamPrx66-1 (EcC051478.60)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx66-1
start..stop
S start..stop
EgrPrx66 661 0 1..323 1..323
EglPrx66 661 0 1..323 1..323
EguPrx66 660 0 1..323 1..323
EgrPrx65 614 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 692..883 192 N° 3 976..1144 169 N° 4 1224..1615 392
join(1..219,692..883,976..1144,1224..1615)


exon

Literature and cross-references EcamPrx66-1 (EcC051478.60)
Protein sequence: EcamPrx66-1 (EcC051478.60)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   34526.47 (31786.1) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.95 (9.81) Peptide Signal:   %s   cut: 27 range:27-323
Sequence 364
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRHPIWVIVAMAFVTTLGWGSASAQLSTNFYSKSCPNVLSTAKSVVQSAVSKERRMGASLLRLFFHDCFVNGCDGSILLDDTSSFQGEKTAGPNQNSVRGYNVIDQIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASLSRANSGVIPPPTSTLSNLISRFKAQGLSTRDMVALSGSHTIGQARCISFRPRIYNDSNIDSSFSKTRQGKCPRTAGSGDNNLSPLDLQSPTAFDNAYFRNLLSNKGLLHSDQELFNGGTTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTTT
TGAGCACGGCGAAATCTGTTGTACAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GTAATCTTTCCTCCCTCCCTCC
CTTTTTCCCAAATTTCTACCTGTTCCCTACATATACTTCCCGGCCACAGCCATTTTTACCATTAAAAACCCGAGTCTTATGTTGTAAACGATGCAAAAGAGCATGCATAATAATTCCACT
ATAAAGGTTGTCTATGACCATTTCTATGAATACACTGGCTTTCTTTCTTTTTGAATAAAAAAAAAAAAAAAGGCCGATTTGGACATTGAAAAATAATGTGATGGCATTCATGCAAACTGG
TCTACGCATATAGAGTTACTTAAGATGATTTGAAAATTAAGTGACTCAGAGTCCACTACAATGCATAAGGCTTTATCAGCCGTTCAATGTTTAATACGTGTGAACTTCTCTAGGGGGAAT
CACTAACTTTTTAGTGGATTATCGATGAGTCTGTCATGTTCAAAGACATGCATGGTTTGACATGGTTAGTTTTGCATCGACCAAAAATAGGGGTGCGACGGCTCGATACTCCTGGATGAC
ACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGGTCTCTTGT
GCAGACATTGTGGCCATTGCTGCTCGCGACTCGGTTGTGCTA
GTATGTATTGAAATTGATATGGCTAGTTGTTCATTTAGTCTGAGCCCCTAAATTGCTGTTATTATCAATTGATGGTGA
TGTGATATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCCAACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCT
CCAACCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCCCTGGCCTCGCTCAGTTGCTAGGTTGCTCATGGGT
CGTGCATGGGTGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGC
AAGTGCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCTCCTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAGGAACCTGCTCAGCAACAAGGGCCTTCTTCAC
TCGGACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAA
CCCCTCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGCAAGATCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTTT
TGAGCACGGCGAAATCTGTTGTACAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GGGTGCGACGGCTCGATACTCC
TGGATGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGG
TCTCTTGTGCAGACATTGTGGCCATTGCTGCTCGCGACTCGGTTGTGCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCCA
ACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAACCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GGTCTCACACCATAGGTCAGG
CAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCTC
CTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAGGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTCG
TCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGCA
AGATCAATTAG

Retrieve as FASTA