Entry information : OsPrx20(LOC_Os01g73170)
Entry ID 1030
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-10 (Christophe Dunand)
Peroxidase information: OsPrx20(LOC_Os01g73170)
Name OsPrx20(LOC_Os01g73170)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Coleoptiles
Leaves
Radicles
Roots
Seeds
Shoots
Inducers Drought
Fungus infection
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx20
start..stop
S start..stop
ZmPrx16 498 5e-178 46..377 31..361
SiPrx06 476 2e-169 52..377 37..357
BdiPrx120 471 2e-167 47..377 33..361
OsPrx22 468 1e-166 47..377 30..356
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42421944..42422435 492 N° 2 42424085..42424726 642  
join(42421944..42422435,42424085..42424726)


exon

Literature and cross-references OsPrx20(LOC_Os01g73170)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1S3
DNA ref. GenBank:   NC_008394.1 (42421980..42424723)
Protein sequence: OsPrx20(LOC_Os01g73170)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377 (340)
PWM (Da):   %s   39500.28 (36071.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.71 (7.12) Peptide Signal:   %s   cut: 26 range:26-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRRSAAASPAMAAAAAVVAVSVYLLVCSAPAAATAAAVAKKPSYPPVAKGLSFDHYKKSCPQAEAIVFSFLRDAIGKDVGLAAALIRLHFHDCFVQGCDASILLTKTPGGPDGEQQAIPNESLRPAAFKAVNDIRALLDRACGRVVSCSDIVTLAARDSVKLAGGPSYKVPLGRRDGLTSATPSQVLGALPPPTSHVPELIAALAKLNLDAADLIALSGAHTVGIAHCTSFTGRLYPKQDGTMDKWFAGQLKLTCPKNDTANTTVNDIRTPNAFDNKYYVDLQNRQGLFTSDQDLFVNATTRPLVAEFAVDQSAFFHQFVFSVVKMGQIQVLTGSQGQIRANCSVRNPGAASADEELPWSAAVETVVEAAESIVL*

Retrieve as FASTA  
Remarks chromosome 1. 39 ESTs (ubiquitous).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCGTAGAAGTGCAGCAGCTAGTCCGGCCATGGCAGCAGCAGCTGCGGTAGTAGCTGTATCTGTATACTTGCTGGTGTGCAGTGCTCCGGCGGCGGCGACGGCGGCGGCGGTG
GCGAAGAAGCCGTCGTACCCGCCGGTGGCGAAGGGGCTATCGTTCGACCACTACAAGAAGAGTTGCCCGCAGGCGGAGGCCATCGTGTTCAGCTTCCTGCGCGACGCCATCGGCAAGGAC
GTCGGCCTCGCCGCGGCGCTGATCCGGCTCCACTTCCACGACTGCTTCGTCCAGGGCTGCGACGCCTCCATCCTCCTCACCAAGACGCCCGGCGGGCCCGACGGCGAGCAGCAGGCGATA
CCCAACGAGTCGCTGCGGCCGGCGGCGTTCAAGGCCGTCAACGACATCCGCGCCCTGCTCGACAGGGCGTGCGGCCGCGTCGTCTCCTGCTCCGACATCGTCACCCTCGCCGCCCGCGAT
TCCGTCAAACTG
GTAACTAACTAAGTTAATTGATTAATTAATATTTTTTTCACTTACTTACTGCCACTGGAAAAGTTTTTCATGGAAGAGGAGATGGATTAAACACTACTGCTATCTAAA
AAGTGGAGTTCATGAATAGAGGATAGGAAAATTAACTTAAGTAATGTGGGTTAGGATTCAAAATTTCCGAATGAAATTTTGGTCATATTAGACCATCCGATACCATACTATTTTAGCTAA
ATTTTTAATTTTTAATTTTTTTCATGAATTTTGGTAATATTTATTTAAATTTGAATAACATATTTTTAAAATTTCAAAAAATTTGAACCGAAATTTCGAAAATATCATCATATCGGCACC
CGATACAGATACCGGAAACAAAAAGTCTGAACCCTGATGTGGGCACTGGCGCACTGCACGATGCTGCCGATGCACGAACTGTGTTTCATCCATCCATGATCCATGCATCTTGTTTCTCCA
ATTTTCTAGTATATCTCGATCTGGCAGCGGACAAGAGACTTTCGTTGTCCGGTCCTAAATTAATCAACAGAAATGACCAAAGAACATCTTACAATATAATGATCATCCCTTTAAAATTCT
CTTAATTAATTAAATACCCAACAATTAATTATGCACGCATCGAAAAACAAAGGGAAAAGAATCTACGCAGAGTTCTGCATGTTAGAAAAGACAATTCCCTTTAAGCTAGCCTTCTTTAGA
GTGAAAGATATTTGGAGATCAATTTGCACGTAAATTAATCTAATTAATTAAGCCATGTAACTGAGTAACAATTCCCTTGAAGAGCCATAGGAAACTATAACGCGGGATAATTGGACTGTC
ACGATCAGTACTTCTGTAGAATTTATTGGCTTGCGAGAAATGGCACAAGAAGAACAAGATAGAGATGAAGGAAACAGGAAATTGTGTTGCTGTCTCAACCACGTGTGGAATCACTGTATC
ATGCCCAATGGCCAAAATTATCAGAACATCGACATCTTAAATAATTAGGACGACTAATACGTGTAACAGATATTAATAAGACCATTTGCTGACTAGGAGTGTACCATCGATGTTCATTAA
CTAATTAATTATTTATTAATCAATTAGTCATTACATATCATTTACTTGCTCTGTTCACGAATATAAACATTTTTAAGGAGTCAAAGCATGGATTAAGATTTAGATGAAATTGTTTTGATG
ACTAGAAATTTTACTAATAATGTTAAAAATACGTTTTCTAAAAAAAATAATGAGATTAAAGATATGATATGGTCCCCATATCTTTGGACTTTGAGTATGTATTAGACTGTTATTAGCGTG
GTGTTGTGTATGTTTGGTTTGTGCATGGTTACGGATGTGCCCGTGTAAATCAATAAATCTTAAAGGAGTAGTTGGACTGGAAAAGTGGTACGGAGTATTACATAAATGTTTGTTCTGGAC
AAATTTAATTAAACGTTAGAAATGTTTACGTCTGTGCAAAGATAAATATTAATCAGTGAATGTTAGAACATACTCCCTCCGTTTCATAATGTAAGTCATTCTTTGATGCCCAATTCTTTG
ATGTAACCCCTACTCTATCAATATACAAGCAAAGCTTTTACCCTCTTTTCAAGAAAAATAAATATAAAAACCAAAATGTTGAACATTGCAATTGGGTGCAGGCCGGTGGGCCGTCGTACA
AGGTGCCGCTCGGCCGCCGTGACGGCCTCACATCGGCGACGCCGTCACAGGTGCTGGGCGCGCTCCCGCCGCCGACCTCCCACGTCCCCGAGCTCATCGCCGCGCTGGCCAAGCTCAACC
TCGACGCCGCCGACCTCATCGCGCTCTCCGGCGCCCACACCGTCGGCATCGCCCACTGCACCTCCTTCACCGGGCGGCTGTACCCGAAGCAGGACGGCACCATGGACAAGTGGTTCGCCG
GCCAGCTCAAGCTGACGTGCCCGAAGAACGACACGGCCAACACCACCGTCAACGACATCCGGACGCCCAACGCCTTCGACAACAAGTACTACGTCGACCTGCAAAACCGCCAGGGCCTCT
TCACCTCCGACCAGGACCTCTTCGTCAACGCCACCACCAGGCCGCTCGTCGCCGAGTTCGCCGTCGACCAGTCGGCGTTCTTCCACCAGTTCGTCTTCTCCGTCGTCAAGATGGGCCAGA
TCCAGGTGCTCACCGGCTCGCAGGGACAGATCCGGGCAAACTGCTCCGTCCGCAACCCCGGCGCCGCCTCCGCCGACGAGGAGCTCCCGTGGTCCGCCGCCGTGGAGACCGTCGTCGAGG
CGGCCGAGAGCATCGTGCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCGTAGAAGTGCAGCAGCTAGTCCGGCCATGGCAGCAGCAGCTGCGGTAGTAGCTGTATCTGTATACTTGCTGGTGTGCAGTGCTCCGGCGGCGGCGACGGCGGCGGCGGTG
GCGAAGAAGCCGTCGTACCCGCCGGTGGCGAAGGGGCTATCGTTCGACCACTACAAGAAGAGTTGCCCGCAGGCGGAGGCCATCGTGTTCAGCTTCCTGCGCGACGCCATCGGCAAGGAC
GTCGGCCTCGCCGCGGCGCTGATCCGGCTCCACTTCCACGACTGCTTCGTCCAGGGCTGCGACGCCTCCATCCTCCTCACCAAGACGCCCGGCGGGCCCGACGGCGAGCAGCAGGCGATA
CCCAACGAGTCGCTGCGGCCGGCGGCGTTCAAGGCCGTCAACGACATCCGCGCCCTGCTCGACAGGGCGTGCGGCCGCGTCGTCTCCTGCTCCGACATCGTCACCCTCGCCGCCCGCGAT
TCCGTCAAACTG
GCCGGTGGGCCGTCGTACAAGGTGCCGCTCGGCCGCCGTGACGGCCTCACATCGGCGACGCCGTCACAGGTGCTGGGCGCGCTCCCGCCGCCGACCTCCCACGTCCCC
GAGCTCATCGCCGCGCTGGCCAAGCTCAACCTCGACGCCGCCGACCTCATCGCGCTCTCCGGCGCCCACACCGTCGGCATCGCCCACTGCACCTCCTTCACCGGGCGGCTGTACCCGAAG
CAGGACGGCACCATGGACAAGTGGTTCGCCGGCCAGCTCAAGCTGACGTGCCCGAAGAACGACACGGCCAACACCACCGTCAACGACATCCGGACGCCCAACGCCTTCGACAACAAGTAC
TACGTCGACCTGCAAAACCGCCAGGGCCTCTTCACCTCCGACCAGGACCTCTTCGTCAACGCCACCACCAGGCCGCTCGTCGCCGAGTTCGCCGTCGACCAGTCGGCGTTCTTCCACCAG
TTCGTCTTCTCCGTCGTCAAGATGGGCCAGATCCAGGTGCTCACCGGCTCGCAGGGACAGATCCGGGCAAACTGCTCCGTCCGCAACCCCGGCGCCGCCTCCGCCGACGAGGAGCTCCCG
TGGTCCGCCGCCGTGGAGACCGTCGTCGAGGCGGCCGAGAGCATCGTGCTCTAG

Retrieve as FASTA