Entry information : EcamPrx109 ( EcC055166.190)
Entry ID 10328
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-12 (Christophe Dunand)
Peroxidase information: EcamPrx109 ( EcC055166.190)
Name (synonym) EcamPrx109 ( EcC055166.190)
Class Class III peroxidase    [Orthogroup: Prx086]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx109
start..stop
S start..stop
EgrPrx109 687 0 1..339 1..339
EguPrx109 645 0 1..339 1..339
EgrPrx105 637 0 1..339 1..339
EcamPrx105 634 0 1..339 1..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..237 237 N° 2 404..595 192 N° 3 747..912 166 N° 4 1066..1487 422
join(1..237,404..595,747..912,1066..1487)


exon

Literature and cross-references EcamPrx109 ( EcC055166.190)
Protein sequence: EcamPrx109 ( EcC055166.190)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (309)
PWM (Da):   %s   36696.38 (33683.8) Transmb domain:   %s   i2-24o
PI (pH):   %s   4.56 (4.56) Peptide Signal:   %s   cut: 31 range:31-339
Sequence 380
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAALFYPGILTMQFLAAIAFISGILGSGASDPPLTLDYYASSCPNVLEIIHQEMEREVLSDPRNAALVPRLHFHDCFVQGCDGSVLLDDTVMLRGEKTASPNINSLKGFEIIDRIKSKVESECPGIVSCADILTIAAKDAVILVGGPYWDVPVGRKDSRSASYELANTNIPTPNQGLIAIIYKFLYLGLSVTDTVALSGAHTIGVARCENFRARIYGDYESTSGSSPLSEVHLSQLKSTCPAAGGGDNNIAPLDYETPYTFDNSYYHLLLNGEGLLNSDQELYSSVLALQTKQLVEQYALDVAAFFQQFSVSMVKMGNLTNPDSFLNGEVRKSCRFINA

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTGCTTTATTTTATCCGGGAATCCTCACGATGCAGTTCTTGGCAGCCATCGCCTTCATTTCTGGCATTTTAGGTTCCGGTGCAAGCGACCCTCCACTGACGCTCGATTATTATGCAT
CCTCGTGCCCAAACGTGCTTGAAATAATCCACCAAGAAATGGAACGTGAGGTGCTCTCTGATCCACGTAACGCTGCTTTAGTACCCCGTCTACACTTCCACGACTGCTTCGTTCAG
GTGC
ATTGCTTATATCGTAACTCTATGCAATTTTATATTCTGTTGTGTTTAATTGAACATGTACTTTGGGATGAAAGTATGCGTTAGTAGTGACAACCGTCTTGAAGCATGGAACAATCTGCAA
AGGGAGTGTTTTCTGAATGTTTTGGATGCAATGTTTTATTAGGGATGCGACGGTTCGGTCCTGTTGGATGATACGGTCATGCTACGAGGAGAGAAGACAGCTTCCCCAAATATAAACTCT
CTAAAAGGTTTTGAAATCATCGATAGGATCAAGAGCAAGGTTGAATCCGAATGCCCTGGAATTGTCTCTTGCGCTGATATATTGACCATTGCTGCTAAAGATGCTGTCATTCTG
GTATAG
ATTGTCCCTCTCTCTCTCTCTGAATTCCTCATTGTCATGTCAAATAATGTTCTAAATTATAACTTCTGTAGTTATTACTTGCTAACCAAGGAGAAATATCAGAAAATCAATGTAACTGAT
ATCGATTCTCTTTCGTACTTTTTAGGTGGGCGGACCATATTGGGATGTTCCGGTGGGGAGAAAAGACTCAAGAAGCGCAAGCTACGAGCTTGCAAACACCAATATTCCTACTCCGAATCA
AGGCCTCATTGCCATCATTTACAAGTTCCTTTACCTCGGCCTCTCTGTCACCGACACCGTCGCACTTTCCG
GTAATTATTAAGTTTCTACTCCTCTTTAAGTGAGCGATCGAATTACTCA
CCCAAGGTGAGCTTATTGCCACAGAAGAAAGCGCGCTGATTAAGACTTGTATAGTACATTGCATGAGACTTTCCTTTTAACTATATGCACATGTGAATCGCTAGGGGCTCACACGATCGG
CGTGGCACGCTGTGAGAACTTCCGTGCAAGAATATATGGGGACTACGAATCGACGTCGGGCAGTAGTCCATTGTCTGAAGTGCACCTGAGCCAATTGAAGTCCACATGCCCGGCCGCAGG
AGGGGGAGACAACAACATCGCGCCTTTGGACTACGAAACGCCCTACACGTTCGACAACTCCTACTACCATTTGCTCCTGAATGGAGAGGGATTGCTCAATTCTGACCAGGAACTATACTC
AAGTGTATTGGCCCTTCAGACCAAGCAGCTTGTGGAACAGTATGCACTTGACGTGGCAGCCTTCTTTCAGCAGTTCTCCGTTTCCATGGTAAAGATGGGGAACCTCACGAATCCGGATAG
CTTTCTCAATGGAGAAGTGAGGAAGAGTTGCAGATTCATCAATGCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTGCTTTATTTTATCCGGGAATCCTCACGATGCAGTTCTTGGCAGCCATCGCCTTCATTTCTGGCATTTTAGGTTCCGGTGCAAGCGACCCTCCACTGACGCTCGATTATTATGCAT
CCTCGTGCCCAAACGTGCTTGAAATAATCCACCAAGAAATGGAACGTGAGGTGCTCTCTGATCCACGTAACGCTGCTTTAGTACCCCGTCTACACTTCCACGACTGCTTCGTTCAG
GGAT
GCGACGGTTCGGTCCTGTTGGATGATACGGTCATGCTACGAGGAGAGAAGACAGCTTCCCCAAATATAAACTCTCTAAAAGGTTTTGAAATCATCGATAGGATCAAGAGCAAGGTTGAAT
CCGAATGCCCTGGAATTGTCTCTTGCGCTGATATATTGACCATTGCTGCTAAAGATGCTGTCATTCTG
GTGGGCGGACCATATTGGGATGTTCCGGTGGGGAGAAAAGACTCAAGAAGCG
CAAGCTACGAGCTTGCAAACACCAATATTCCTACTCCGAATCAAGGCCTCATTGCCATCATTTACAAGTTCCTTTACCTCGGCCTCTCTGTCACCGACACCGTCGCACTTTCCG
GGGCTC
ACACGATCGGCGTGGCACGCTGTGAGAACTTCCGTGCAAGAATATATGGGGACTACGAATCGACGTCGGGCAGTAGTCCATTGTCTGAAGTGCACCTGAGCCAATTGAAGTCCACATGCC
CGGCCGCAGGAGGGGGAGACAACAACATCGCGCCTTTGGACTACGAAACGCCCTACACGTTCGACAACTCCTACTACCATTTGCTCCTGAATGGAGAGGGATTGCTCAATTCTGACCAGG
AACTATACTCAAGTGTATTGGCCCTTCAGACCAAGCAGCTTGTGGAACAGTATGCACTTGACGTGGCAGCCTTCTTTCAGCAGTTCTCCGTTTCCATGGTAAAGATGGGGAACCTCACGA
ATCCGGATAGCTTTCTCAATGGAGAAGTGAGGAAGAGTTGCAGATTCATCAATGCA

Retrieve as FASTA