Entry information : EcamAPx08 (EcC031756.30)
Entry ID 10425
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status partial
Reviewer Li
Last annotation changes 2013-05-23 (Li)
Peroxidase information: EcamAPx08 (EcC031756.30)
Name (synonym) EcamAPx08 (EcC031756.30)
Class Ascorbate peroxidase     [Orthogroup: APx002]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamAPx08
start..stop
S start..stop
EglAPx08 719 0 1..352 95..446
EgrAPx08 717 0 1..352 95..446
EguAPx08 711 0 1..352 95..446
VvAPx06 643 0 1..352 72..424
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..111 111 N° 2 590..710 121 N° 3 784..884 101 N° 4 995..1082 88
N° 5 1760..1827 68 N° 6 1914..2000 87 N° 7 3205..3279 75 N° 8 3367..3444 78
N° 9 3530..3634 105 N° 10 4142..4213 72 N° 11 4500..4652 153  
join(1..111,590..710,784..884,995..1082,1760..1827,1914..2000,3205..3279,3367..3 444,3530..3634,4142..4213,4500..4652)


exon

Literature and cross-references EcamAPx08 (EcC031756.30)
Protein sequence: EcamAPx08 (EcC031756.30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352
PWM (Da):   %s   38563.81 Transmb domain:   %s   o332-351i
PI (pH):   %s   6.03
Sequence 393
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
YSGAASPKCAVSDPEQLKGAREEIKELLKTKFCHPLLVRLGWHDAGTYNKNIEEWPKRGGANGSLRFEIELKHAANAGLVNALKLIEPIKEKYPSVTYADLFQLAGATAIEEAGGPKLPMKYGRVDVSKPEECPEEGRLPDAGPPSPADHLREVFYRMGLNDKEIVALSGAHTLGRSRPERSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKERKDEDLLVLPTDGVLFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPPEGIVIDGPAKAAPEKFVAATYSSGKRELSDAMKQKIRAEYEGFGGSPDKPLQSNYFLNIIIVIAALALLSSLVVN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa. (5' end is missing)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAGCGGAGCCGCGTCTCCTAAATGCGCCGTGTCTGATCCGGAGCAGCTGAAGGGCGCCAGGGAAGAAATTAAGGAGCTTCTCAAGACTAAGTTCTGTCATCCTCTTCTGGTAACGTGCC
TTCGTATCCTCTGCAAAAGGATTAGTTCTTATTCTGCCTGTTTGTGTCATTTGTTTGAATTAGCCGGTTCTGATTTTCAGTGATTTTGGAAGATATATACTTTAATCGCGGCACGAGATG
ATGCTGAATGAACGAAATTGCTCTTGCTATTGTAATGTGTTTAGCCTACTGCACAGATTCATCTATCCCCTGAAGAAAGCATATCTATTTTTGGAATGAACCCTTAGTTGAGAAAATACA
CCTCTGAGATGCTATGGATAATTGAAGCACCTGAGATTTTGAAACTTCATTACATTGTTCCCATCCATTTAGCTAGCTGACAACAGAGAACTGTAAATCCTGAAGTGGCTAATCGCCATG
TTCCCACTCGTCTATGCAATCTACTAGGTCTGACAGTCTCTGTATTACATGTGTTTTGTAGGAAAAGGAAATAGAATTTGCCGTTAATGACATATGAGTACTTTACAGGTTCGGTTGGGA
TGGCATGATGCTGGTACTTATAATAAGAACATCGAAGAATGGCCTAAAAGAGGTGGAGCTAACGGGAGTCTTCGGTTTGAAATTGAGCTTAAGCATGCAGCTAATGCTG
GTAATAATTTA
GCAGTGATACTACGGGTGGCATGACTTGTTTCTTGAACTTCTCTCAAAACTAGCTTTTACAGGTCTTGTAAATGCACTAAAACTTATTGAGCCAATCAAAGAAAAATATCCCAGTGTGAC
ATATGCAGACTTGTTTCAGCTGGCTGGTGCTACTGCTATCGAG
GTCAGTTTTTGCGCTCTTAATTGCTTAACCTGAGATTTCTTGAAGCCATATGTAACCTGAGATTCACTCGTTCTTTG
TGAAAATGTTCTTCCTTTTACTTTATTCTTCAGGAAGCTGGTGGTCCCAAGCTTCCCATGAAGTATGGAAGAGTTGATGTCTCAAAACCTGAGGAGTGCCCTGAGGAAGGGAGGCTTCCT
G
GTGAGTGAAACATTGTTGTTCATTAAAGAGTAGACATCCACTCGGCTTTGTTGTACTAGGGGATCACTAATTTGGCTCTATGAAGCACTGTAACTATCTCGCGCAAGTTGTTGCGATGT
GCCGATTATTCGACTGCTTTTTCTATGATAAATCTGAGTGGGCACCCTAACACGCAAAGGCTTCTTTTTTAGGTGAGATTTGTACTTAAGGTTGAAGGTGGTAATTTTAAAGAACTGTAA
TTTGCTGATTTGGGCAACAGATGAAGTTCTAGATGACTTGATTCATTTAGGCATTTACTAAAAAAATTCAAGCAACAAGAGATGTATTCATCCTAGGTCTGTGTTTTGTTTCTGAATGGA
TCACATTCGTATGCGTGGTAAGCTCTTGAAACAAAGCATTGTTTGGAAAAAAAAAAGAATATGCATTTAGATGCGCTTTATCACACATAAATGAACTTGAATATCCCGTCCTTGCTATGG
TCAGAAGTCATTTTCTATCTCTCGTCTGGAGTTTTCACTTTTTTATTCTGTCTCCAGTGATTGATTTCTTCTCTTTCTCGGATCCTTTTGTCTCACTTATTAGTGTACTTTCTACTTCTG
CCAGAAAAAAAAGTTTTTGTCGGTTCCTCTTGGAACAATCCATTTCTTCTCTTTTTACTGAACAGTTCTTTCTTTCAGATGCTGGCCCCCCTTCACCAGCCGATCATCTCCGGGAAGTTT
TCTACAGGATGGGACTAAATGACAAG
GTTTTTGTAATCGTTACCTAATGGGATGTTGTGTGCTATTTGTGTGTATCTCATGTGCTTGAGACTATGAATTCTCTGTTCTGCAGGAAATCGT
TGCTTTATCTGGGGCACACACTCTTGGAAGGTCAAGACCAGAACGTAGTGGGTGGGGCAAGCCAGAAACAAAGTACACG
GTAACTAATTACTTTCTATTTATTAATGTAATGCTCTGTAC
TAATCATTTGACAAACTCAACTTGCCATAGGAATTCTGAAACAGCATGCATAGTGTCGAGAATGTATTTTCCATGGTTACCATTGGTGAATTGAAAGTTATCCTCGATATACAATTAGAG
TTATGAACTCTTGACCATCTTTAAACGAATAACAGGGAACAGGACTCTGATGGTCATAGTCTTGTCCATTAAACGTGAAAAACTACAGAAATGTTATGTTTGGATTTAGAAACAATATTT
CATTGAGCTCCAAGCACTTAAGGAGCTGTGCAGTAGGATGGCGTTCTATCAGTGATCAACCATCAGAAATAGATTGATATTCCCAAGGACGTTGTTGTAAATTCTTTTATGTGCTTGTAA
TCTCCATTGTCTCACACAGTTGCGACTCATGATTCGGGTTACAATATTTTGGCTTGATGGTCACGATGATGCCCAGAAAAAGTAGCCATTTATAGTGTGGCTTGTGACTACGTTAATGAA
TCTCGATAGCCATATTTGTTGCCATGGGATTTGCGCCTCAGAGTCTCTTTTGTTAAGGATGACAGTTGTCTATTAATTTCCATAGAGGAGGTCCATATCAACTGATATTTGCAGATCTTT
TCTTCTAGGAGTACAAGAAGCAAGCATTTTAGGGGTTAGTTGGTCAGCTTAAAGAGTTTGTTTACATCATTACCGTCTGTGTAGTATCAAATCTTCTATAAAACTCAAGAACTCGGCATC
TTTCTAAAAAGTATCCATCCATGTCTTTTAGGTCTTATTTACCTCTTTTACATGTGTCCATTGTAATGTCACATCTTCTTACTTTTATCATCTGTAGGCCATTGCCTTTTGTGTCCAAAC
TACTTTAGCAAGGTTTTTCATCTTATTCCCACTTTAAGCCACCCCCTCAGCTATGATCTGTTCTAACTTGATCTTGTGTTAGTGTCCAAATATCCTTAGGCATTATTATCTTAGCTATAT
TAGTTTGGTACGTGTGCCTTTCTTACCGACAGTAGAAATGGTTGTGGACATTGAAGCTTGGGAAAAGTTTCTCCCCAGTAGACAAATTAATGGCTGCTTGAATTGAACTTATATGACTAT
TTTCAACAATATAGTTTAGTTGAAATGATTAAGAATAGTATAAATGGCCTTCATGAATCGTAATGGCCTCCATCGTGTCACAGAAAGATGGACCAGGAGCACCAGGTGGACAGTCGTGGA
CCGTGCAATGGTTAAAGTTTGATAACTCATACTTCAAG
GTTTGCGAGTTGAATCCATACGTACTTTTTCCATGGGAAGGTGGTGATTCAGAATCAAGTGGGATGCTAACTTGATGTTTCA
TGCAGGATATAAAAGAACGGAAGGATGAAGACCTGCTGGTATTGCCAACTGATGGTGTTCTTTTTGAAGATCCTTCATTCAAGGTAATAAGAGTTTTTCTGAAAGCTCCAAAACAAAAGA
AGTCTCTCAATTTGAGTTATCTTTCTAAAGAATGTTAGCGAATTGCAGGTCTATGCTGAGAAATACGCTGAAGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCACATGCAAAACTC
AGCAACCTTGGTGCAAAATTTGATCCTCCAGAG
GTTTGTCAGTGCTCTCTTATGGTCATTCCTTTGCTAATTGTAGTGACGCTGGACCGTGTTCGACTCTTTTCCAATGCCTTCTTAATT
TTAAGTTTTTAAGGAGCCAATGGCCAAAGTTCTATAAGAACTGTCCGAATATTTGAAATTCTTCCATGACGTTCATGTTGGCTATTTGACCATCTGTTGTGATGGCATTGGCCTCTGGAT
CAAGTGAAATTTGCAGGATTGATGGGGCCTCCCATTTGGAGACGCATCAATTGTAGTTTTATTGCCAAATATTGCACGGCATGAATAACCATCAAGTTCATCTTATCAGCATTGATGTTT
GGCTTGTTATGAAAAATTTGTGCGTAGATAACAAGCGCTTCTACCTATTTACAAATTTTTCTTGGGTCTAGATTTACAAGTTTTTCTTCAGTCTAGATTTACTAGTTTGCAATTTAACTT
ATACAGAACTTGGGTTAGAGTTGTGGTGAAAACTAAAGCTTACGTTGAGTAATCTTTCAGGGTATCGTGATAGATGGTCCTGCTAAAGCTGCACCGGAGAAGTTTGTGGCTGCCACCTAC
TCATCTGGAAAG
GTTATACTAAGAAATAACTTACATCTTGATCTTCCATTGTTACAGAGAGTTCCTTTTCATTATGTGATCTTTAACGGAGAGACTATTTCTTTGCAAATTGTTCATGTT
CCTTGTTTCTTATGGTTTGCTGCAGGATTAGAAAACAATGTCCCGTTTTCTGTGCCGTGTCTTTTATAAATAAAAGATGGAAGATATTTTCAATCTTGTGAAACCACTTCTTAAAACTTG
GGGAGTCTTAGCGAAAGGAGGAATAAAATTCAACGCGTGTTGCGTATTTGAATTGCAGAGAGAACTGTCAGATGCTATGAAGCAGAAGATCCGAGCTGAGTATGAAGGATTCGGTGGCAG
CCCAGATAAGCCCCTGCAATCCAACTATTTTCTGAACATAATCATTGTCATTGCTGCTTTGGCACTCTTGTCATCTCTAGTAGTAAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACAGCGGAGCCGCGTCTCCTAAATGCGCCGTGTCTGATCCGGAGCAGCTGAAGGGCGCCAGGGAAGAAATTAAGGAGCTTCTCAAGACTAAGTTCTGTCATCCTCTTCTGGTTCGGTTGG
GATGGCATGATGCTGGTACTTATAATAAGAACATCGAAGAATGGCCTAAAAGAGGTGGAGCTAACGGGAGTCTTCGGTTTGAAATTGAGCTTAAGCATGCAGCTAATGCTG
GTCTTGTAA
ATGCACTAAAACTTATTGAGCCAATCAAAGAAAAATATCCCAGTGTGACATATGCAGACTTGTTTCAGCTGGCTGGTGCTACTGCTATCGAG
GAAGCTGGTGGTCCCAAGCTTCCCATGA
AGTATGGAAGAGTTGATGTCTCAAAACCTGAGGAGTGCCCTGAGGAAGGGAGGCTTCCTG
ATGCTGGCCCCCCTTCACCAGCCGATCATCTCCGGGAAGTTTTCTACAGGATGGGACTAA
ATGACAAG
GAAATCGTTGCTTTATCTGGGGCACACACTCTTGGAAGGTCAAGACCAGAACGTAGTGGGTGGGGCAAGCCAGAAACAAAGTACACGAAAGATGGACCAGGAGCACCAGGTG
GACAGTCGTGGACCGTGCAATGGTTAAAGTTTGATAACTCATACTTCAAG
GATATAAAAGAACGGAAGGATGAAGACCTGCTGGTATTGCCAACTGATGGTGTTCTTTTTGAAGATCCTT
CATTCAAG
GTCTATGCTGAGAAATACGCTGAAGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCACATGCAAAACTCAGCAACCTTGGTGCAAAATTTGATCCTCCAGAGGGTATCG
TGATAGATGGTCCTGCTAAAGCTGCACCGGAGAAGTTTGTGGCTGCCACCTACTCATCTGGAAAG
AGAGAACTGTCAGATGCTATGAAGCAGAAGATCCGAGCTGAGTATGAAGGATTCG
GTGGCAGCCCAGATAAGCCCCTGCAATCCAACTATTTTCTGAACATAATCATTGTCATTGCTGCTTTGGCACTCTTGTCATCTCTAGTAGTAAATTGA

Retrieve as FASTA