Entry information : EgrPrx66
Entry ID 10461
Creation 2012-02-07 (Qiang Li)
Last sequence changes 2012-02-13 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-03 (Achraf Jemmat)
Peroxidase information: EgrPrx66
Name EgrPrx66
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx66
start..stop
S start..stop
EglPrx66 662 0 1..323 1..323
EguPrx66 662 0 1..323 1..323
EcamPrx66-1 661 0 1..323 1..323
EgrPrx65 615 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 64037720..64037938 219 N° 2 64038406..64038597 192 N° 3 64038690..64038858 169 N° 4 64038938..64039329 392
join(64037720..64037938,64038406..64038597,64038690..64038858,64038938..64039329 )


exon

Literature and cross-references EgrPrx66
DNA ref. Phytozome 12:   scaffold_2 (64037720..64039329)
Protein sequence: EgrPrx66
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   34498.46 (31758.1) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.93 (9.80) Peptide Signal:   %s   cut: 27 range:27-323
Sequence 364
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRHPIWVIVAMAFVTTLGWGSASAQLSTNFYSKSCPNVLSTAKSVVQSAVSKERRMGASLLRLFFHDCFVNGCDGSILLDDTSSFQGEKTAGPNQNSVRGYNVIDQIKSKVESACPGVVSCADIVAIAARDSVVLLGGPSWEVKLGRRDARTASLSRANSGVIPPPTSTLSNLISRFKAQGLSTRDMVALSGSHTIGQARCISFRPRIYNDSNIDSSFSKTRQGKCPRTAGSGDNNLSPLDLQSPTAFDNAYFKNLLSNKGLLHSDQELFNGGTTDSLVKTYSNNPKTFNSDFASAMIKMGDIKPLTGSKGEIRKICSKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTTT
TGAGCACGGCGAAATCTGTTGTCCAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GTAATCTTTCCTTCCTCCCTCC
CTTTTTCCCAAATTTCTACCTGTTCCCTACATATACTTCCCGGCCACAGCCATTTTTACCATTAAAAACCCGAGTCTTATGTTGTAAACGATGCAAAAGAGCATGCATAATAATTCCACT
ATAAAGGTTGTCTATGACCATTTCTATGAATACACTGGCTTTCTTTCTTTTTGAATAAAAAAAAAAGGCCGATTTGGACATTGAAAAATAATGTGATGGCATTCATGCAAACTGATCTAC
GCATATAGAGTTACTTAAGATGATTTGAAAATTAAGTGACTCAGAGTCCACTACAATGCATAAGGCTTTATCAGCCGTTCAATGTTTAATACGTGTGAACTTCTCTAGGGGGAATCACTA
ACTTTTTAGTGGATTATCGATGAATCTGTCATGTTCAAAGACATGCATGGTTTGACATGGTTAGTTTTGCATCGACCAAAAATAGGGGTGCGACGGCTCGATACTCCTGGATGACACATC
CTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGGTCTCTTGTGCAGA
CATTGTGGCCATTGCTGCTCGCGACTCGGTCGTGCTA
GTATGTATTGAAATTGATATGGCTAGTTGTTCATTTAGTCTGAGCCCCTAAATTGCTGTTATTATCAATTGATGGTGATGTGA
TATTTGAAGCTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCCAACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAAC
CTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GTACGTGTTTAATATTGCAGTCCCTGGCCTCGCTCAGTTGCTAGGTTGCTCATGGGTCGTGC
ATGGGCGTGCATTGCAGGGTCTCACACCATAGGTCAGGCAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTG
CCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCTCCTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGA
CCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTCGTCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCT
CACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGCAAGATCAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTAGTCGACATCCGATTTGGGTAATTGTCGCCATGGCTTTTGTAACCACGCTCGGGTGGGGCAGTGCCTCCGCACAACTCTCTACAAACTTCTACTCCAAAAGTTGCCCCAACGTTT
TGAGCACGGCGAAATCTGTTGTCCAGTCCGCGGTGTCGAAAGAGCGCCGCATGGGTGCTTCTCTACTTCGCCTCTTCTTTCATGATTGCTTCGTCAAT
GGGTGCGACGGCTCGATACTCC
TGGATGACACATCCTCGTTCCAAGGGGAGAAGACGGCCGGCCCAAATCAGAATTCAGTAAGAGGATACAACGTCATCGACCAGATCAAGTCCAAGGTGGAGTCCGCCTGTCCAGGTGTGG
TCTCTTGTGCAGACATTGTGGCCATTGCTGCTCGCGACTCGGTCGTGCTA
CTGGGCGGGCCAAGTTGGGAAGTGAAACTGGGAAGAAGAGACGCAAGGACCGCGAGTTTGTCACGCGCCA
ACAGCGGAGTCATTCCCCCTCCAACTTCAACGCTCTCCAACCTCATCTCTAGATTCAAAGCTCAAGGCCTCTCCACCAGGGACATGGTTGCCTTGTCTG
GGTCTCACACCATAGGTCAGG
CAAGGTGCATAAGCTTCAGACCTCGCATATACAACGACAGCAACATCGACAGCTCCTTTAGCAAGACTAGGCAGGGCAAGTGCCCCCGCACCGCTGGGTCTGGGGACAACAACCTGTCTC
CTCTCGACCTCCAATCCCCCACCGCCTTCGACAACGCCTACTTCAAGAACCTGCTCAGCAACAAGGGCCTTCTTCACTCGGACCAGGAGCTCTTCAATGGGGGAACCACTGACTCTCTCG
TCAAGACGTACTCCAACAACCCCAAGACCTTCAACTCTGATTTTGCTTCCGCCATGATCAAGATGGGTGACATCAAACCCCTCACGGGTTCCAAAGGCGAAATTCGGAAGATCTGTAGCA
AGATCAATTAG

Retrieve as FASTA