Entry information : EgrPrx115
Entry ID 10466
Creation 2012-02-07 (Qiang Li)
Last sequence changes 2012-02-13 (Qiang Li)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-03-19 (Catherine Mathe)
Peroxidase information: EgrPrx115
Name EgrPrx115
Class Class III peroxidase    [Orthogroup: Prx080]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx115
start..stop
S start..stop
EglPrx115 662 0 1..322 1..322
EcamPrx115 660 0 1..322 1..322
EguPrx115 656 0 1..322 1..322
EgrPrx116 597 0 1..322 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49727152..49727370 219 N° 2 49727957..49728148 192 N° 3 49728245..49728410 166 N° 4 49728847..49729238 392
join(49727152..49727370,49727957..49728148,49728245..49728410,49728847..49729238 )


exon

Literature and cross-references EgrPrx115
DNA ref. Phytozome 12:   scaffold_7 (49727152..49729238)
Protein sequence: EgrPrx115
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (296)
PWM (Da):   %s   34531.18 (32022.8)  
PI (pH):   %s   6.96 (6.65) Peptide Signal:   %s   cut: 27 range:27-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSSFSKAVLTLVCVVLLVGGTSAQLSIYHYAETCPQLCPTVKSIVQAEIAKEARMGASLLRLFFHDCFVNGCDGSNLLDDTPTFTGEKNAAPNRNSLRGFEVVDKIKAAVENVCPGVVSCADLLAIISRDAVEILGGPGWDVKLGRRDARTASQAAANNSIPPPTDSLNALISGFQNHGLSQKDLVALYGAHTVGQARCTNFRARIYNESNIDSSFAEAMKSNCPSVAGVGDNNLDGLDFQSATSFDNTYYINLMRKRGLLHSDQQLFNGGSTDSLIRTYAQSQETFFKDFVASMINMGDIKPLTGSNGEIRKNCRRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCGTCTTCTTCGTTTTCAAAGGCCGTTTTGACTTTGGTTTGTGTCGTGCTCCTTGTCGGTGGCACGAGTGCCCAACTTTCGATTTACCACTATGCCGAAACTTGCCCCCAACTC
TGCCCGACGGTGAAGTCAATCGTGCAGGCAGAGATCGCCAAGGAGGCCCGCATGGGTGCCTCGCTCCTCCGCTTGTTCTTCCACGATTGCTTCGTCAAT
GTAGCTTCTCTTTCTCATCCA
CTTTAACTTCTCAACATCCATTGCCGCTATTTAAAACCTATTCATACATGTTTCTTTCGCCATTTGCATATGTGTCCTACGAATTTTGTGGTCCATTGATTCGTCAACAGAGGTGTAATT
TAATGCATCGGTCAAGCCTAGACAACACTCTCTCCATTTCTTCGTGGTCTAGTAATTGGCTAAATCCTTCTTGTCCTCATCTATAGCGCGAGTTCGACATAGTCAGAGAAGAATAAATAA
AACGAAAGTAGGGTGTCGGTTTGTCTTGTCCGTGGTCCAATGCAAATACGTAAAAAGAAACGCTTGACTTAGTATGTCATTTGTAAGGTACGAATTCCATGCAAAAACAAAAGAAAGCAC
TTTGACCTTGTAAGCCATCATGAAGAAAGATACTGCGCTGAAGTCAAGTTCCCATTTGCTAAATTTAAAAGCATAGTTTTATTGGCTGGGGATTGTAATATATCATTTGAAAAATTCGTC
GATGCTCATAGCTAAGAAAGAGTTCGGTTCACTAAACAACAAATCAAAGTCATTGTATTTTCGATATTCATGGTTTATTGATCAGGGTTGCGATGGATCGAACCTCTTGGATGACACACC
TACTTTCACCGGAGAGAAAAACGCGGCCCCGAACAGAAATTCCTTGCGAGGGTTCGAAGTGGTGGACAAGATTAAGGCTGCAGTGGAGAATGTTTGCCCCGGCGTCGTCTCCTGTGCTGA
TTTGTTGGCTATTATCTCCCGAGATGCCGTTGAGATA
GTAAGTCAGTGGAACTCGACTAGCAATGGAATAGTAGAGATGAAAGCTTCTGATTATTTTGCGTGGGTAATAATTTGTTGAGT
ATGAATTGGGCAGCTGGGAGGGCCAGGGTGGGATGTGAAGCTGGGAAGGAGAGATGCAAGGACTGCGAGCCAGGCAGCAGCTAACAATAGCATTCCTCCTCCAACTGATAGCCTCAATGC
TCTCATTTCCGGCTTCCAGAATCACGGCCTTTCTCAAAAGGACCTCGTCGCTCTATACG
GTGAACTCTCTCTCTCTCTCTCTCTCTCCACCATAAGATATGTATATAGCTTGCATTTTAC
GAGTTTTACTAAGGTATGCTTTAGGGCATTTGTTAAGCGATGTTATAAATTGAATTTTTATAACACTTGATAAGTATACAAAATCCTCATAAAATTGAAAAATCGGTTCATACAAAATTA
CAGCATTTCTTTATTTGCAAAAATCTTTGAATATATGATTTTTTACGAGAAAGTACTATAGAGACTGCATATATTAGATCAAGTCTATCACACATCAAGAATCTATGAGATCCACACTGG
GCCCCCCTAAAAAACCAAACTTTTCATATAATTTCTGCATTTTAATTGGGTTTGTCCATCTTATCACCCATAGATCGAGTCTATATAGTATTCTTAAATACTTATTTGTATGCCCTCCTA
CTCTTAACTATTCAGGAGCACACACAGTTGGGCAAGCAAGATGCACAAACTTTCGGGCCAGAATCTACAACGAGAGCAACATCGACAGCTCATTTGCCGAAGCGATGAAGAGCAACTGCC
CGAGCGTCGCCGGCGTCGGCGACAACAACCTGGACGGGCTCGACTTCCAGAGCGCGACATCATTCGACAACACCTATTACATCAACCTCATGAGGAAAAGAGGCCTCCTCCACTCTGACC
AACAGCTCTTCAACGGCGGGTCCACCGACTCGCTCATCAGGACTTACGCCCAAAGCCAAGAGACCTTCTTCAAAGACTTTGTGGCCTCCATGATCAATATGGGCGACATCAAGCCCCTTA
CCGGATCCAACGGCGAGATCAGGAAGAACTGTAGGAGGATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCGTCTTCTTCGTTTTCAAAGGCCGTTTTGACTTTGGTTTGTGTCGTGCTCCTTGTCGGTGGCACGAGTGCCCAACTTTCGATTTACCACTATGCCGAAACTTGCCCCCAACTC
TGCCCGACGGTGAAGTCAATCGTGCAGGCAGAGATCGCCAAGGAGGCCCGCATGGGTGCCTCGCTCCTCCGCTTGTTCTTCCACGATTGCTTCGTCAAT
GGTTGCGATGGATCGAACCTC
TTGGATGACACACCTACTTTCACCGGAGAGAAAAACGCGGCCCCGAACAGAAATTCCTTGCGAGGGTTCGAAGTGGTGGACAAGATTAAGGCTGCAGTGGAGAATGTTTGCCCCGGCGTC
GTCTCCTGTGCTGATTTGTTGGCTATTATCTCCCGAGATGCCGTTGAGATA
CTGGGAGGGCCAGGGTGGGATGTGAAGCTGGGAAGGAGAGATGCAAGGACTGCGAGCCAGGCAGCAGCT
AACAATAGCATTCCTCCTCCAACTGATAGCCTCAATGCTCTCATTTCCGGCTTCCAGAATCACGGCCTTTCTCAAAAGGACCTCGTCGCTCTATACG
GAGCACACACAGTTGGGCAAGCA
AGATGCACAAACTTTCGGGCCAGAATCTACAACGAGAGCAACATCGACAGCTCATTTGCCGAAGCGATGAAGAGCAACTGCCCGAGCGTCGCCGGCGTCGGCGACAACAACCTGGACGGG
CTCGACTTCCAGAGCGCGACATCATTCGACAACACCTATTACATCAACCTCATGAGGAAAAGAGGCCTCCTCCACTCTGACCAACAGCTCTTCAACGGCGGGTCCACCGACTCGCTCATC
AGGACTTACGCCCAAAGCCAAGAGACCTTCTTCAAAGACTTTGTGGCCTCCATGATCAATATGGGCGACATCAAGCCCCTTACCGGATCCAACGGCGAGATCAGGAAGAACTGTAGGAGG
ATTAATTAA

Retrieve as FASTA