Entry information : OsPrx40(LOC_Os03g22020)
Entry ID 1050
Creation 2006-06-23 (Filippo Passardi)
Last sequence changes 2006-06-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-10 (Christophe Dunand)
Peroxidase information: OsPrx40(LOC_Os03g22020)
Name OsPrx40(LOC_Os03g22020)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx40
start..stop
S start..stop
SofPrx11 535 0 11..325 7..318
ZmPrx120 519 0 20..325 16..320
SiPrx165 517 0 13..325 1..312
SbPrx18 510 0 19..325 21..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12590521..12590733 213 N° 2 12590196..12590390 195 N° 3 12589537..12590109 573  
complement(join(12589537..12590109,12590196..12590390,12590521..12590733))


exon

Literature and cross-references OsPrx40(LOC_Os03g22020)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1Q3
DNA ref. GenBank:   NC_008396.1 (12590718..12589540)
Protein sequence: OsPrx40(LOC_Os03g22020)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   34107.11 (31884.0)  
PI (pH):   %s   6.5 (6.50) Peptide Signal:   %s   cut: 20 range:20-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSSAMAAVAVAFAVVVAATMSSAQLDPHFYDGLCPAALPTIKRIVEEAVAAEPRMGASLLRLHFHDCFVNGCDGSILLDDTPFFTGEKNAAPNMNSVRGFDVIDRIKDAVNAACRRNVVSCADIVAVAARDSIVTLGGPSYHVPLGRRDARTASQAAANSSIPAPTLNLDGLVSSFAAQGLSVQDLVLLSGAHTLGFSRCTNFRDRLYNETATLDASLAASLGGTCPRTAGAGDDNLAPLDPTPARFDAAYYASLLRARGLLHSDQQLFAGGGLGATDGLVRFYAANPDAFRRDFAESMVRMASLSPLVGSQGEVRVNCRKVNYY*

Retrieve as FASTA  
Remarks chromosome 3. 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCCTCTGCTATGGCGGCGGTGGCGGTGGCGTTTGCTGTAGTGGTGGCCGCGACGATGAGCAGCGCGCAACTTGACCCGCACTTCTACGACGGCTTGTGCCCGGCGGCGCTGCCC
ACCATCAAGCGGATCGTCGAGGAGGCCGTCGCGGCGGAGCCCCGCATGGGCGCCTCGCTCCTGCGCCTGCACTTCCACGACTGCTTCGTCAAC
GTAAGTAAATCAAATCGGCATCGATCA
GCATGGCATGAACACGTTAAGATCTTGTTGATTGTTTTCTTGATCGATCGATCTGTCGATATGCTTGTGATGATCGGTAATGGATGGACATATGCGTGATCAGGGTTGCGACGGGTCCAT
CCTGCTGGACGACACGCCATTCTTCACGGGGGAGAAGAACGCGGCGCCCAACATGAACTCCGTCCGCGGCTTCGACGTCATCGACCGCATCAAGGACGCCGTCAACGCCGCCTGCCGCCG
CAACGTCGTCTCCTGCGCCGACATCGTCGCCGTCGCCGCGCGCGACTCCATCGTCACC
GTGCGTACCATACCTGAAACCTAGCTTTGGCAATGGCATCGCTCACTGAACTGAATGCATTC
ATGCATGTGTGTGTGCGCGCGCAGCTGGGAGGGCCGTCGTACCACGTGCCGCTGGGCCGGAGGGACGCGCGGACGGCGAGCCAGGCGGCGGCGAACAGCAGCATCCCGGCGCCGACGCTC
AACCTCGACGGCCTCGTCTCCAGCTTCGCCGCGCAGGGCCTCTCCGTGCAGGACCTCGTCCTCCTCTCCGGCGCCCACACGCTGGGCTTCTCCCGCTGCACCAACTTCCGCGACCGCCTC
TACAACGAGACGGCCACGCTCGACGCCTCCCTCGCCGCGTCGCTCGGGGGGACCTGCCCGCGTACCGCCGGCGCCGGCGACGACAACCTCGCGCCGCTCGACCCGACGCCGGCGAGGTTC
GACGCCGCGTACTACGCCTCGCTGCTGCGCGCCAGGGGGCTCCTGCACTCGGACCAGCAGCTGTTCGCCGGCGGCGGCCTCGGCGCCACCGACGGGCTCGTCAGGTTCTACGCCGCCAAC
CCGGACGCGTTCCGGCGAGACTTCGCCGAGTCCATGGTGAGGATGGCCAGCCTGAGCCCGCTCGTCGGGAGCCAAGGCGAGGTCCGCGTCAACTGCAGGAAGGTGAACTACTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTCCTCTGCTATGGCGGCGGTGGCGGTGGCGTTTGCTGTAGTGGTGGCCGCGACGATGAGCAGCGCGCAACTTGACCCGCACTTCTACGACGGCTTGTGCCCGGCGGCGCTGCCC
ACCATCAAGCGGATCGTCGAGGAGGCCGTCGCGGCGGAGCCCCGCATGGGCGCCTCGCTCCTGCGCCTGCACTTCCACGACTGCTTCGTCAAC
GGTTGCGACGGGTCCATCCTGCTGGAC
GACACGCCATTCTTCACGGGGGAGAAGAACGCGGCGCCCAACATGAACTCCGTCCGCGGCTTCGACGTCATCGACCGCATCAAGGACGCCGTCAACGCCGCCTGCCGCCGCAACGTCGTC
TCCTGCGCCGACATCGTCGCCGTCGCCGCGCGCGACTCCATCGTCACC
CTGGGAGGGCCGTCGTACCACGTGCCGCTGGGCCGGAGGGACGCGCGGACGGCGAGCCAGGCGGCGGCGAAC
AGCAGCATCCCGGCGCCGACGCTCAACCTCGACGGCCTCGTCTCCAGCTTCGCCGCGCAGGGCCTCTCCGTGCAGGACCTCGTCCTCCTCTCCGGCGCCCACACGCTGGGCTTCTCCCGC
TGCACCAACTTCCGCGACCGCCTCTACAACGAGACGGCCACGCTCGACGCCTCCCTCGCCGCGTCGCTCGGGGGGACCTGCCCGCGTACCGCCGGCGCCGGCGACGACAACCTCGCGCCG
CTCGACCCGACGCCGGCGAGGTTCGACGCCGCGTACTACGCCTCGCTGCTGCGCGCCAGGGGGCTCCTGCACTCGGACCAGCAGCTGTTCGCCGGCGGCGGCCTCGGCGCCACCGACGGG
CTCGTCAGGTTCTACGCCGCCAACCCGGACGCGTTCCGGCGAGACTTCGCCGAGTCCATGGTGAGGATGGCCAGCCTGAGCCCGCTCGTCGGGAGCCAAGGCGAGGTCCGCGTCAACTGC
AGGAAGGTGAACTACTACTAG

Retrieve as FASTA