Entry information : PoVP03_PC9 (VP3)
Entry ID 10515
Creation 2012-02-21 (Christophe Dunand)
Last sequence changes 2012-02-21 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-26 (Nizar Fawal)
Peroxidase information: PoVP03_PC9 (VP3)
Name (synonym) PoVP03_PC9 (VP3)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP03_PC9
start..stop
S start..stop
PoVP03_PC15 724 0 1..360 1..360
PoVP01_PC15 598 0 1..360 1..361
PoVP01_IFO30160 595 0 1..360 1..361
PpulVP01 593 0 1..360 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3247854..3247917 64 N° 2 3247666..3247799 134 N° 3 3247549..3247607 59 N° 4 3247363..3247497 135
N° 5 3247186..3247307 122 N° 6 3247055..3247130 76 N° 7 3246966..3247002 37 N° 8 3246905..3246912 8
N° 9 3246773..3246853 81 N° 10 3246648..3246717 70 N° 11 3246577..3246586 10 N° 12 3246491..3246526 36
N° 13 3246258..3246430 173 N° 14 3246162..3246201 40 N° 15 3246079..3246103 25 N° 16 3246008..3246020 13
complement(join(3246008..3246020,3246079..3246103,3246162..3246201,3246258..3246 430,3246491..3246526,3246577..3246586,3246648..3246717,3246773..3246853,3246905. .3246912,3246966..3247002,3247055..3247130,3247186..3247307,3247363..3247497,324 7549..3247607,3247666..3247799,3247854..3247917))


exon

Literature and cross-references PoVP03_PC9 (VP3)
DNA ref. JGI genome:   scaffold_2 (3247917..3246008)
Cluster/Prediction ref. JGI gene:   123383
Protein sequence: PoVP03_PC9 (VP3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (338)
PWM (Da):   %s   37526.72 (35292.5)  
PI (pH):   %s   4.31 (4.31) Peptide Signal:   %s   cut: 23 range:23-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFASLSALVFALGAALQAVNAVTLPQKRATCAGGQVTANAACCVLFPILEDLQQNLFDGGECGEEVHESLRLTFHDAIGFSPTKGGGGADGSVLTFSDPEVNFPANLGIDEIVEAQKPFLARHNISAGDLVQFAGALGVSNCPGAPRIPFFLGRPPAKAASPIGLVPEPFDTVTDILDRMGDAGFAAVEVVWLLSSHTIAAADHVDESIPGTPFDSTPSIFDSQFFIETQLRGTSFPGSGGNHGEVESPLAGEIRLQSDHLLARDSRTSCEWQSMVDNMPKIQNRFAATMLKMSLLGQNQADLIDCSDVIPTPPALVGKAHLPAGKVQSDVEQACATTPFPAIAADPGPVTAVPPVPPS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (15 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTTCGCCTCTCTTTCCGCTCTTGTTTTTGCATTAGGCGCGGCTCTCCAGGCCGTCAATGGTAACCCTTTCCTATGGCCATCATGAAATACCGTGTTGATATTCCGATCGCCAGCC
GTAACTTTGCCCCAGAAGCGCGCGACTTGCGCTGGCGGTCAAGTCACTGCCAACGCTGCTTGCTGTGTCCTCTTCCCAATCTTGGAAGACCTTCAGCAGAACCTCTTCGACGGCGGCGAA
TGCGGTGAAGAA
GTACGCTACTTGTGTTTACTGCTGCTTTCTTTGCCTTACCATCCACGCTCGTCGCTAGGTGCACGAATCCCTTCGCCTAACATTCCACGACGCCATTGGATTCTCTCC
CACCAAAGG
GTAAATCGTTGTGCTTGAGGCCATTTTACTTTACTTATCCATCGTGTGCAGTGGAGGCGGCGCTGATGGTTCCGTCCTTACGTTCTCTGACCCGGAAGTCAACTTCCCGGC
TAACCTCGGTATTGACGAAATTGTCGAGGCGCAGAAACCATTCCTTGCAAGACACAACATATCCGCAGGTGACCT
GTACGTTCCTCGTCGACTTAACTTTGTAAGGTGTCACTGAATTGC
CTTTATGTAGAGTCCAATTCGCTGGTGCATTAGGTGTTTCCAACTGCCCGGGTGCCCCTCGAATCCCGTTCTTCTTGGGTCGCCCCCCAGCCAAGGCGGCGTCTCCAATTGGCTTGGTCC
CCGAACCGTTCG
GTAAGCGACTTTTGATGCCATTGTACGACAAAGTATCGCTCACTGCTTTAAATAGATACCGTAACAGACATTCTAGACAGAATGGGCGACGCTGGATTTGCTGCCGTC
GAGGTCGTCTGGCTCCTTTCTTC
GTATGTCCCATATTATTCATCAATGACTTCAATTCTAATGCAGATAATTCAGACACACAATCGCTGCAGCCGATCATGTAGACGAAAGTGTAAGTCC
CACATCTCCGTCATCTCGCTGGTCCTGACATAATCTTTGATAAAGATTCCTGGGTGAGCTCTAAGGTGTGAGTCCGTCTAGCGTGGTGGCTTACTTATGTTTAGAACCCCGTTCGACTCG
ACGCCGTCCATCTTCGACTCTCAATTCTTCATCGAGACCCAACTCCGTGGAACTTCCTTCCCAGG
GTAATGAATTAGCATGGTCTACCATCTGTGTGCACAAAGCTCACTTGTTATACAG

ATCTGGTGGTAACCACGGTGAGGTTGAGTCGCCCTTGGCGGGTGAAATCAGGCTTCAATCCGACCACTTG
GTGAGTCTTTTCCATCCTGCCCCTTCGAATTTCATGTCTAACGCTTCCGC
GTCTCTTACAGCTTGCCCGAGGTGCTTAAACCAATTGTCTGCCTCGAATCATACTGAAGCAGTATAATTAGACTCCAGGACTTCCTGTGAATGGCAGTCCATGGTTGGTAAGCGCCACCT
TCTATTTCCCACCTGTCGCCTGGGAGCTCACCGTTAATGGCAAATAGACAATATGCCGAAGATCCAGAACCGTTTCGCAGCGACCATGCTTAAGATGTCGTTGCTCGGACAGAACCAGGC
CGACTTGATCGACTGTTCTGATGTCATCCCCACGCCCCCTGCTCTCGTAGGCAAGGCACATCTCCCCGCCGGAAAGGTCCAGTCCGATGTCGAACAAGCC
GTATGTTGCATATTACCCTC
GCGGATCGTGCAATAACCCCCACTTCTTCTTTCTAGTGTGCCACCACCCCCTTCCCAGCTATCGCTGCCGACCCTGGTAAGCAAATAGAATCCACAGACGGTGTACAATTTCTGACCCGT
TGTCCGCTATCTAGGTCCAGTCACCGCTGTCCCTCCCGTGTACGTACCAATTCAGCTAAATCTGCACGTACGCCTTGACGCTAAACCCATGGTCCAGCCCCCCTTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTTCGCCTCTCTTTCCGCTCTTGTTTTTGCATTAGGCGCGGCTCTCCAGGCCGTCAATGCCGTAACTTTGCCCCAGAAGCGCGCGACTTGCGCTGGCGGTCAAGTCACTGCCAAC
GCTGCTTGCTGTGTCCTCTTCCCAATCTTGGAAGACCTTCAGCAGAACCTCTTCGACGGCGGCGAATGCGGTGAAGAA
GTGCACGAATCCCTTCGCCTAACATTCCACGACGCCATTGGA
TTCTCTCCCACCAAAGG
TGGAGGCGGCGCTGATGGTTCCGTCCTTACGTTCTCTGACCCGGAAGTCAACTTCCCGGCTAACCTCGGTATTGACGAAATTGTCGAGGCGCAGAAACCATTC
CTTGCAAGACACAACATATCCGCAGGTGACCT
AGTCCAATTCGCTGGTGCATTAGGTGTTTCCAACTGCCCGGGTGCCCCTCGAATCCCGTTCTTCTTGGGTCGCCCCCCAGCCAAGGCG
GCGTCTCCAATTGGCTTGGTCCCCGAACCGTTCG
ATACCGTAACAGACATTCTAGACAGAATGGGCGACGCTGGATTTGCTGCCGTCGAGGTCGTCTGGCTCCTTTCTTCACACACAATC
GCTGCAGCCGATCATGTAGACGAAAGT
ATTCCTGGAACCCCGTTCGACTCGACGCCGTCCATCTTCGACTCTCAATTCTTCATCGAGACCCAACTCCGTGGAACTTCCTTCCCAGGATCT
GGTGGTAACCACGGTGAGGTTGAGTCGCCCTTGGCGGGTGAAATCAGGCTTCAATCCGACCACTTG
CTTGCCCGAGACTCCAGGACTTCCTGTGAATGGCAGTCCATGGTTGACAATATG
CCGAAGATCCAGAACCGTTTCGCAGCGACCATGCTTAAGATGTCGTTGCTCGGACAGAACCAGGCCGACTTGATCGACTGTTCTGATGTCATCCCCACGCCCCCTGCTCTCGTAGGCAAG
GCACATCTCCCCGCCGGAAAGGTCCAGTCCGATGTCGAACAAGCC
TGTGCCACCACCCCCTTCCCAGCTATCGCTGCCGACCCTGGTCCAGTCACCGCTGTCCCTCCCGTCCCCCCTTCG
TAA

Retrieve as FASTA