Entry information : PoVP03_PC15
Entry ID 10523
Creation 2012-02-22 (Christophe Dunand)
Last sequence changes 2012-02-22 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-04-16 (Christophe Dunand)
Peroxidase information: PoVP03_PC15
Name PoVP03_PC15
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP03_PC15
start..stop
S start..stop
PoVP03_PC9 724 0 1..360 1..360
PoVP01_PC15 600 0 1..360 1..361
PoVP01_IFO30160 596 0 1..360 1..361
PpulVP01 595 0 1..360 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 214467..214530 64 N° 2 214279..214412 134 N° 3 214162..214220 59 N° 4 213976..214110 135
N° 5 213799..213920 122 N° 6 213668..213743 76 N° 7 213579..213615 37 N° 8 213518..213525 8
N° 9 213386..213466 81 N° 10 213261..213330 70 N° 11 213190..213199 10 N° 12 213104..213139 36
N° 13 212872..213044 173 N° 14 212776..212815 40 N° 15 212693..212717 25 N° 16 212622..212634 13
complement(join(212622..212634,212693..212717,212776..212815,212872..213044,2131 04..213139,213190..213199,213261..213330,213386..213466,213518..213525,213579..2 13615,213668..213743,213799..213920,213976..214110,214162..214220,214279..214412 ,214467..214530))


exon

Literature and cross-references PoVP03_PC15
DNA ref. JGI genome:   scaffold_04 (214530..212622)
Cluster/Prediction ref. JGI gene:   156336
Protein sequence: PoVP03_PC15
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (338)
PWM (Da):   %s   37492.73 (35292.5)  
PI (pH):   %s   4.31 (4.31) Peptide Signal:   %s   cut: 23 range:23-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFASLSALVLALGAALQAVNAVTLPQKRATCAGGQVTANAACCVLFPILEDLQQNLFDGGECGEEVHESLRLTFHDAIGFSPTKGGGGADGSVLTFSDPEVNFPANLGIDEIVEAQKPFLARHNISAGDLVQFAGALGVSNCPGAPRIPFFLGRPPAKAASPIGLVPEPFDTVTDILDRMGDAGFAAVEVVWLLSSHTIAAADHVDESIPGTPFDSTPSIFDSQFFIETQLRGTSFPGSGGNHGEVESPLAGEIRLQSDHLLARDSRTSCEWQSMVDNMPKIQNRFAATMLKMSLLGQNQADLIDCSDVIPTPPALVGKAHLPAGKVQSDVEQACATTPFPAIAADPGPVTAVPPVPPS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (15 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTTCGCCTCTCTTTCCGCTCTTGTTCTTGCATTAGGCGCGGCTCTCCAGGCCGTCAATGGTAACCATTTCCTATGGCCATCATGAAATACCGTGTTCATATTCCGATCGCCAGCC
GTAACTTTGCCCCAGAAGCGCGCGACTTGCGCTGGCGGTCAAGTCACTGCCAACGCTGCTTGCTGTGTCCTCTTCCCAATCTTGGAAGACCTTCAGCAGAACCTCTTCGACGGCGGCGAA
TGCGGTGAAGAA
GTACGCTACTTGTGGTTACTGCTGGTTTCTTTGCCTTACTATCTACGCTCGTCGCTAGGTGCACGAATCCCTTCGCCTAACATTCCACGACGCCATTGGATTCTCTCC
CACCAAAGG
GTAAATCGTTGTGCTTGAGGCCATTTTACTTTACTTATCCATCGTGTGCAGTGGAGGCGGCGCTGATGGTTCCGTCCTTACGTTCTCTGACCCGGAAGTCAACTTCCCGGC
TAACCTCGGTATTGACGAAATTGTCGAGGCGCAGAAACCATTCCTTGCAAGACACAACATATCCGCAGGTGACCT
GTACGTTCCTCGTCGGTTTACCTTTGTAAGGTGTCACTGAATTGC
CTTTATGTAGAGTCCAATTCGCTGGCGCATTAGGTGTTTCCAACTGCCCGGGTGCCCCGCGAATCCCGTTCTTCTTGGGTCGCCCCCCAGCCAAGGCGGCGTCTCCAATTGGCTTGGTTC
CCGAACCGTTCG
GTAAGCGAATCTTGATGCCATTGTACGACAAAGTATCGCTCACTGCTTTAAATAGATACCGTAACAGACATTCTAGACAGAATGGGCGACGCTGGATTTGCTGCCGTT
GAGGTCGTCTGGCTCCTTTCTTC
GTATGTCCCATATTATTCATCAATGACTTCAATTCTAACGCAGATAATTCAGACACACAATCGCTGCAGCCGACCATGTAGATGAAAGTGTAAGTCC
CACATCTCCGTCACCTCGCTGGTCCTGATATAACCTTTGATGAAGATTCCTGGGTGAGCTCTAAGGTGTGAGTCCGTCTAGCGCGGTGGCTTACTTATGTTTAGAACCCCATTCGACTCG
ACGCCGTCCATCTTCGACTCTCAATTCTTCATCGAGACCCAACTCCGTGGAACTTCCTTCCCAGG
GTAATGAATTAGCACGGTCTACCATCTGTGTGCACAAAGCTCACTTGTTGTACAG

ATCCGGTGGTAACCACGGTGAGGTTGAGTCGCCTTTGGCGGGTGAAATCAGGCTTCAATCCGACCACTTG
GTGAGTCTTTTCCATCCTGCCCCTTCGAATCTCATGTCTAACGCTTCCGC
GTCTCTTACAGCTTGCCCGAGGTGCTTAAACCAATTGTCTGCCTCGAATCATACTGAAGCAGTATAATTAGACTCCAGGACTTCCTGTGAATGGCAGTCCATGGTTGGTAAGCGCCACCT
TCTATTTCTGCCTGTCGCCTGGGAGCTCACCGTTAATGGCAAATAGACAATATGCCGAAGATCCAGAACCGTTTCGCAGCGACCATGCTTAAGATGTCGCTGCTCGGACAGAACCAGGCC
GACTTGATCGACTGTTCTGATGTCATCCCCACGCCCCCTGCTCTCGTAGGCAAGGCACATCTCCCCGCCGGAAAGGTCCAGTCCGACGTCGAACAAGCC
GTATGTCGCATATTATCCTCG
CGGATCGTGCAATAACCCCCACTTCTTCTTTCTAGTGTGCCACCACCCCCTTCCCAGCTATCGCTGCCGACCCTGGTAAGCAAATAGAATCCACAGACGGTGTACAATTTCTGACCCGTT
GTCCGCTATCTAGGTCCAGTCACCGCTGTCCCTCCCGTGTACGTACCAATTCAGCTAAATCTGCACGTACGCCTTGACGCTAAACCCATGGTCCAGCCCCCCTTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTTCGCCTCTCTTTCCGCTCTTGTTCTTGCATTAGGCGCGGCTCTCCAGGCCGTCAATGCCGTAACTTTGCCCCAGAAGCGCGCGACTTGCGCTGGCGGTCAAGTCACTGCCAAC
GCTGCTTGCTGTGTCCTCTTCCCAATCTTGGAAGACCTTCAGCAGAACCTCTTCGACGGCGGCGAATGCGGTGAAGAA
GTGCACGAATCCCTTCGCCTAACATTCCACGACGCCATTGGA
TTCTCTCCCACCAAAGG
TGGAGGCGGCGCTGATGGTTCCGTCCTTACGTTCTCTGACCCGGAAGTCAACTTCCCGGCTAACCTCGGTATTGACGAAATTGTCGAGGCGCAGAAACCATTC
CTTGCAAGACACAACATATCCGCAGGTGACCT
AGTCCAATTCGCTGGCGCATTAGGTGTTTCCAACTGCCCGGGTGCCCCGCGAATCCCGTTCTTCTTGGGTCGCCCCCCAGCCAAGGCG
GCGTCTCCAATTGGCTTGGTTCCCGAACCGTTCG
ATACCGTAACAGACATTCTAGACAGAATGGGCGACGCTGGATTTGCTGCCGTTGAGGTCGTCTGGCTCCTTTCTTCACACACAATC
GCTGCAGCCGACCATGTAGATGAAAGT
ATTCCTGGAACCCCATTCGACTCGACGCCGTCCATCTTCGACTCTCAATTCTTCATCGAGACCCAACTCCGTGGAACTTCCTTCCCAGGATCC
GGTGGTAACCACGGTGAGGTTGAGTCGCCTTTGGCGGGTGAAATCAGGCTTCAATCCGACCACTTG
CTTGCCCGAGACTCCAGGACTTCCTGTGAATGGCAGTCCATGGTTGACAATATG
CCGAAGATCCAGAACCGTTTCGCAGCGACCATGCTTAAGATGTCGCTGCTCGGACAGAACCAGGCCGACTTGATCGACTGTTCTGATGTCATCCCCACGCCCCCTGCTCTCGTAGGCAAG
GCACATCTCCCCGCCGGAAAGGTCCAGTCCGACGTCGAACAAGCC
TGTGCCACCACCCCCTTCCCAGCTATCGCTGCCGACCCTGGTCCAGTCACCGCTGTCCCTCCCGTCCCCCCTTCG
TAA

Retrieve as FASTA