Entry information : StheCIIAA01
Entry ID 10527
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-27 (Catherine Mathe (Scipio))
Peroxidase information: StheCIIAA01
Name StheCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Chaetomiaceae Thielavia
Organism Sporotrichum thermophile (Myceliophthora thermophila)    [TaxId: 573728 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value StheCIIAA01
start..stop
S start..stop
CcochCIIAA 393 1e-137 69..358 1..319
LfluCIIAA02 358 3e-123 25..360 1..338
MEspCIIAA02_NRRL54901 327 4e-110 24..359 22..358
CgloCIIAA01_Naragc5 326 5e-110 17..359 13..359
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2662397..2663389 993 N° 2 2663486..2663581 96  
join(2662397..2663389,2663486..2663581)


exon

Literature and cross-references StheCIIAA01
DNA ref. JGI genome:   chromosome_4 (2662397..2663581)
Cluster/Prediction ref. JGI gene:   2111272
Protein sequence: StheCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (343)
PWM (Da):   %s   38155.21 (36006.0)  
PI (pH):   %s   5.16 (4.86) Peptide Signal:   %s   cut: 20 range:20-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKIRYVFLLFLGLASPGVSRTLLGMNKSLAGEISPAAAKRQTGELLADLSTLPDAALSPAGWTIKNILLGNRAAVSPQDLTTVYTAPGPLDSSECRRETCCVWKYIADAMATSFRDGAGRCNELARQAVRLGFHDAGTWSKSAGGGGADGSVLLAPSELARDDNRALEVVAAQMAAWYAEWRPRGARMADLIQMGAVVAAASCPLGPRARAFVGRNDSATPAPPDRLPSAANSDAAALAALFADKTLSLGELVALVGAHTTSVQRFFDPLAAGSPQDSTPGVWDTLYYNQTASSDPPQGVFRFPSDLALSQYPPARELWQTFANAQAVWNDDFAAAYVHLSVLGVEHINDLTECTGVLPLSG*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCAGATATGTATTCCTCCTCTTCCTCGGCCTCGCTTCGCCTGGGGTCTCTCGGACTCTCCTGGGTATGAACAAATCTCTCGCCGGAGAAATCTCACCCGCCGCCGCGAAGCGT
CAGACAGGGGAACTCCTAGCGGACCTCAGCACCCTCCCTGACGCCGCTCTGTCACCGGCGGGCTGGACGATCAAGAACATTCTGCTCGGCAACCGCGCGGCCGTATCACCGCAGGACCTG
ACCACCGTCTACACGGCCCCGGGACCGCTCGACAGCTCCGAATGCCGCCGCGAGACCTGCTGCGTGTGGAAGTACATCGCAGACGCCATGGCTACGTCCTTCCGCGACGGCGCCGGCAGG
TGTAACGAGCTCGCGCGCCAGGCGGTCCGCCTGGGCTTCCATGACGCCGGCACGTGGTCGAAGTCCGCGGGCGGCGGCGGCGCCGATGGGTCCGTCCTCTTGGCTCCCAGTGAGCTGGCG
CGGGACGACAACCGCGCCCTCGAGGTCGTCGCGGCACAAATGGCGGCCTGGTACGCGGAGTGGCGGCCCCGCGGCGCCCGCATGGCCGACCTGATCCAGATGGGCGCGGTGGTAGCAGCC
GCGTCATGCCCGCTGGGCCCCCGGGCACGCGCCTTCGTCGGGCGCAACGACAGTGCCACACCCGCCCCTCCGGACCGGCTCCCCTCGGCCGCCAACAGCGACGCCGCCGCGCTGGCGGCG
CTGTTTGCTGACAAGACGCTCAGCCTCGGCGAGCTTGTCGCCCTCGTCGGTGCCCACACCACCAGCGTTCAGCGGTTCTTCGACCCGCTCGCCGCCGGGTCCCCGCAGGACTCTACGCCG
GGCGTCTGGGACACCCTCTACTACAACCAGACGGCCAGCTCGGATCCTCCGCAGGGCGTGTTTCGTTTCCCGAGCGACCTGGCGCTGTCGCAATACCCCCCCGCGCGTGAGCTGTGGCAA
ACATTTGCGAATGCGCAGGCTGTGTGGAATGAT
GTGAGCTTCATTTTGCCATGTGTATTTTTCATGCGTCTTCTTCCTTTTTCACTGGTGAGAGACAGGAAGAGACAAGGTGCTAATGCT
GGCTTGCAGGACTTTGCCGCTGCGTACGTACACCTTAGCGTGCTCGGTGTTGAGCACATCAATGACCTGACAGAGTGCACCGGTGTGCTGCCATTGTCGGGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCAGATATGTATTCCTCCTCTTCCTCGGCCTCGCTTCGCCTGGGGTCTCTCGGACTCTCCTGGGTATGAACAAATCTCTCGCCGGAGAAATCTCACCCGCCGCCGCGAAGCGT
CAGACAGGGGAACTCCTAGCGGACCTCAGCACCCTCCCTGACGCCGCTCTGTCACCGGCGGGCTGGACGATCAAGAACATTCTGCTCGGCAACCGCGCGGCCGTATCACCGCAGGACCTG
ACCACCGTCTACACGGCCCCGGGACCGCTCGACAGCTCCGAATGCCGCCGCGAGACCTGCTGCGTGTGGAAGTACATCGCAGACGCCATGGCTACGTCCTTCCGCGACGGCGCCGGCAGG
TGTAACGAGCTCGCGCGCCAGGCGGTCCGCCTGGGCTTCCATGACGCCGGCACGTGGTCGAAGTCCGCGGGCGGCGGCGGCGCCGATGGGTCCGTCCTCTTGGCTCCCAGTGAGCTGGCG
CGGGACGACAACCGCGCCCTCGAGGTCGTCGCGGCACAAATGGCGGCCTGGTACGCGGAGTGGCGGCCCCGCGGCGCCCGCATGGCCGACCTGATCCAGATGGGCGCGGTGGTAGCAGCC
GCGTCATGCCCGCTGGGCCCCCGGGCACGCGCCTTCGTCGGGCGCAACGACAGTGCCACACCCGCCCCTCCGGACCGGCTCCCCTCGGCCGCCAACAGCGACGCCGCCGCGCTGGCGGCG
CTGTTTGCTGACAAGACGCTCAGCCTCGGCGAGCTTGTCGCCCTCGTCGGTGCCCACACCACCAGCGTTCAGCGGTTCTTCGACCCGCTCGCCGCCGGGTCCCCGCAGGACTCTACGCCG
GGCGTCTGGGACACCCTCTACTACAACCAGACGGCCAGCTCGGATCCTCCGCAGGGCGTGTTTCGTTTCCCGAGCGACCTGGCGCTGTCGCAATACCCCCCCGCGCGTGAGCTGTGGCAA
ACATTTGCGAATGCGCAGGCTGTGTGGAATGAT
GACTTTGCCGCTGCGTACGTACACCTTAGCGTGCTCGGTGTTGAGCACATCAATGACCTGACAGAGTGCACCGGTGTGCTGCCATTG
TCGGGTTGA

Retrieve as FASTA