Entry information : SturCIIAC01
Entry ID 10539
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SturCIIAC01
Name SturCIIAC01
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturCIIAC01
start..stop
S start..stop
CheCIIAC04_C5 543 0 1..346 7..347
CheCIIAC04_C4 543 0 1..346 7..347
COsaCIIAC04 536 0 1..346 7..347
ClunCIIAC01 526 0 1..346 7..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1684602..1684836 235 N° 2 1683744..1684549 806  
complement(join(1683744..1684549,1684602..1684836))


exon

Literature and cross-references SturCIIAC01
DNA ref. JGI genome:   scaffold_12 (1684836..1683744)
Cluster/Prediction ref. JGI gene:   26293
Protein sequence: SturCIIAC01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (324)
PWM (Da):   %s   38008.87 (35651.6)  
PI (pH):   %s   8.56 (8.56) Peptide Signal:   %s   cut: 23 range:23-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPLLGLSLLTSAGPLQQREAVPTAGKAYGGDMFNDVFGEVEIMMQEISNGDMSAMDDKKTQKPEKCGKGSTDKCCVWYDVSAELTKLFVGQDRQCNDNARGAVRMGFHDAGSWEQGSGDGGADGSLIMDFGEQDRRENNGLQNIRNVLRDVQKKYKVGYADLVQYAHNHATVSCPKGPRVRTFIGRKDATKANQGSLLPDTRDDPNNLIALFKRKGISERELAALLGAHTTARQRFVDTSSAAVNKPLDGTNGVWDVEFYNDTLNNPVGATANQKVFVLPSDKALSQHPKVKGDWSRFVGNQGGWNNEYARAYIKVSMFGVKREQLRKMVDCTQTLPASRNTFP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGCCCCTTCTTGGCCTTTCTCTCCTGACATCAGCGGGTCCATTGCAGCAGCGTGAAGCAGTGCCAACAGCGGGAAAAGCCTATGGTGGCGACATGTTTAATGATGTGTTTGGC
GAAGTCGAAATTATGATGCAAGAGATTTCAAATGGCGACATGTCTGCTATGGATGATAAAAAGACGCAAAAACCCGAGAAATGTGGAAAGGGGAGTACAGACAAGTGTTGCGTTT
GTAAG
TCGATCCACTCATATCTCTATTGCACCCCAAACTGACAAAATCCAAGGGTATGATGTTTCGGCTGAGCTGACAAAACTTTTTGTCGGGCAAGACAGGCAGTGTAATGACAACGCGCGAGG
AGCAGTTCGTATGGGTTTCCACGACGCTGGATCCTGGGAGCAGGGCTCTGGCGATGGTGGCGCTGACGGATCGCTGATTATGGACTTTGGCGAGCAAGATCGACGCGAAAACAATGGTCT
TCAAAATATACGCAACGTGCTACGCGACGTGCAGAAAAAGTACAAGGTGGGATATGCCGATCTTGTACAATATGCTCACAATCACGCCACCGTCTCGTGCCCGAAAGGACCGCGCGTGCG
AACATTCATCGGACGTAAGGATGCTACCAAGGCTAATCAGGGTAGCCTCCTCCCTGATACGCGCGACGACCCTAACAACCTGATTGCACTCTTCAAAAGAAAGGGCATTTCCGAGCGCGA
ACTTGCAGCTCTCTTGGGTGCTCATACCACAGCCCGCCAACGTTTTGTCGACACCTCTTCAGCGGCTGTCAACAAGCCTCTCGACGGTACTAATGGCGTCTGGGATGTCGAGTTCTACAA
CGACACACTCAACAACCCCGTCGGCGCGACTGCTAACCAAAAGGTCTTTGTCCTCCCCAGTGACAAGGCGCTCTCGCAGCACCCCAAAGTGAAGGGCGACTGGAGCCGCTTTGTTGGTAA
CCAAGGTGGTTGGAATAACGAATACGCCAGGGCTTACATCAAGGTCAGCATGTTTGGAGTCAAGAGGGAACAGCTGCGCAAGATGGTTGACTGCACCCAGACGCTGCCTGCTAGCCGAAA
CACTTTTCCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGCCCCTTCTTGGCCTTTCTCTCCTGACATCAGCGGGTCCATTGCAGCAGCGTGAAGCAGTGCCAACAGCGGGAAAAGCCTATGGTGGCGACATGTTTAATGATGTGTTTGGC
GAAGTCGAAATTATGATGCAAGAGATTTCAAATGGCGACATGTCTGCTATGGATGATAAAAAGACGCAAAAACCCGAGAAATGTGGAAAGGGGAGTACAGACAAGTGTTGCGTTT
GGTAT
GATGTTTCGGCTGAGCTGACAAAACTTTTTGTCGGGCAAGACAGGCAGTGTAATGACAACGCGCGAGGAGCAGTTCGTATGGGTTTCCACGACGCTGGATCCTGGGAGCAGGGCTCTGGC
GATGGTGGCGCTGACGGATCGCTGATTATGGACTTTGGCGAGCAAGATCGACGCGAAAACAATGGTCTTCAAAATATACGCAACGTGCTACGCGACGTGCAGAAAAAGTACAAGGTGGGA
TATGCCGATCTTGTACAATATGCTCACAATCACGCCACCGTCTCGTGCCCGAAAGGACCGCGCGTGCGAACATTCATCGGACGTAAGGATGCTACCAAGGCTAATCAGGGTAGCCTCCTC
CCTGATACGCGCGACGACCCTAACAACCTGATTGCACTCTTCAAAAGAAAGGGCATTTCCGAGCGCGAACTTGCAGCTCTCTTGGGTGCTCATACCACAGCCCGCCAACGTTTTGTCGAC
ACCTCTTCAGCGGCTGTCAACAAGCCTCTCGACGGTACTAATGGCGTCTGGGATGTCGAGTTCTACAACGACACACTCAACAACCCCGTCGGCGCGACTGCTAACCAAAAGGTCTTTGTC
CTCCCCAGTGACAAGGCGCTCTCGCAGCACCCCAAAGTGAAGGGCGACTGGAGCCGCTTTGTTGGTAACCAAGGTGGTTGGAATAACGAATACGCCAGGGCTTACATCAAGGTCAGCATG
TTTGGAGTCAAGAGGGAACAGCTGCGCAAGATGGTTGACTGCACCCAGACGCTGCCTGCTAGCCGAAACACTTTTCCATAG

Retrieve as FASTA