Entry information : SturCIIAB03
Entry ID 10540
Creation 2012-02-27 (Christophe Dunand)
Last sequence changes 2012-02-27 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2016-12-21 (Marcel Zamocky)
Peroxidase information: SturCIIAB03
Name SturCIIAB03
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Setosphaeria
Organism Setosphaeria turcica    [TaxId: 93612 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SturCIIAB03
start..stop
S start..stop
AbraCIIAB01 440 2e-156 1..335 1..327
AalteCIIAB02 436 7e-155 1..335 1..327
ClunCIIAB03 416 4e-147 1..335 1..333
COsaCIIAB01 411 3e-145 1..335 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 327050..327644 595 N° 2 326576..326988 413  
complement(join(326576..326988,327050..327644))


exon

Literature and cross-references SturCIIAB03
Protein ref. UniProtKB:   R0K5Z1
DNA ref. JGI genome:   scaffold_15 (327644..326576)
Cluster/Prediction ref. JGI gene:   46691
Protein sequence: SturCIIAB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (316)
PWM (Da):   %s   35195.76 (33119.6)  
PI (pH):   %s   6.88 (6.13) Peptide Signal:   %s   cut: 20 range:20-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYIRNVVLAGLAAASTVQAFNETVEHDGWIVEYPVPVAQKKRTLSGILGVLEGLLPKPSSPPAQGGTCPPIWTQISATLTQQFSANGQCTDAARAAIRAAFHDCFPGACDGSLILANECAQPVNAAMTRICSNLANVASQTKVGVADLIQFAAAHAIKTCPGGPIVPVKVGRKDSSVANDIAILPSGFARGDDLVRLFGSKGFSPVDLSALIGAHSTAKQQGTDPARAGAALDTTPGAWDVKYYSETLAGTAPFTLQSDKNIARNPATAQSFQQFARSQGAWNAAFVPAMVKMSMMGVNPAGLIDCTSALPGGNRKREEEEEEEEERTIFGRLRF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTCGCAACGTTGTTCTCGCCGGCCTCGCCGCCGCCAGCACCGTGCAAGCCTTCAATGAAACCGTTGAACACGATGGCTGGATAGTCGAGTACCCGGTTCCGGTCGCCCAGAAG
AAGCGTACACTGTCCGGTATACTCGGCGTTCTCGAGGGGCTCCTCCCAAAGCCGTCTTCGCCTCCCGCCCAGGGAGGTACTTGCCCCCCCATCTGGACGCAAATCTCCGCCACCCTCACC
CAGCAGTTTTCGGCAAACGGCCAGTGCACAGATGCGGCCAGAGCGGCTATCAGAGCGGCATTTCACGATTGCTTCCCGGGAGCTTGTGATGGCTCGCTCATCCTCGCCAATGAGTGCGCT
CAGCCGGTGAATGCCGCCATGACGCGCATCTGCAGCAACCTTGCAAACGTTGCCTCGCAGACCAAAGTGGGCGTGGCCGATCTCATCCAGTTCGCTGCTGCACACGCCATCAAGACATGT
CCTGGCGGCCCCATCGTCCCCGTCAAAGTAGGCCGCAAGGACTCCAGCGTGGCAAACGACATTGCCATTCTGCCCAGCGGCTTTGCCCGGGGAGACGACCTGGTCCGGCTATTTG
GTAAT
TATTCCTTTTCCACAGCACATGGTCATCCAGTCAAGCTTACACAACTATCCTGTAGGATCCAAGGGGTTCTCGCCCGTCGACCTTTCCGCTCTCATCGGCGCTCACAGCACAGCCAAGCA
ACAGGGCACCGATCCGGCGCGCGCGGGTGCAGCCCTCGACACCACGCCCGGTGCCTGGGACGTCAAGTACTACAGCGAGACGCTTGCGGGAACCGCTCCTTTTACCTTACAGTCTGACAA
GAACATTGCACGCAACCCTGCTACGGCCCAGTCCTTCCAGCAATTTGCAAGGAGCCAGGGAGCGTGGAACGCTGCTTTTGTCCCGGCCATGGTCAAGATGAGCATGATGGGTGTAAATCC
CGCTGGCTTGATCGACTGCACGAGCGCGCTTCCTGGCGGTAACAGGAAGAGGGAAGAGGAGGAGGAGGAGGAGGAGGAGAGGACCATTTTTGGTCGTCTGAGATTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTATATTCGCAACGTTGTTCTCGCCGGCCTCGCCGCCGCCAGCACCGTGCAAGCCTTCAATGAAACCGTTGAACACGATGGCTGGATAGTCGAGTACCCGGTTCCGGTCGCCCAGAAG
AAGCGTACACTGTCCGGTATACTCGGCGTTCTCGAGGGGCTCCTCCCAAAGCCGTCTTCGCCTCCCGCCCAGGGAGGTACTTGCCCCCCCATCTGGACGCAAATCTCCGCCACCCTCACC
CAGCAGTTTTCGGCAAACGGCCAGTGCACAGATGCGGCCAGAGCGGCTATCAGAGCGGCATTTCACGATTGCTTCCCGGGAGCTTGTGATGGCTCGCTCATCCTCGCCAATGAGTGCGCT
CAGCCGGTGAATGCCGCCATGACGCGCATCTGCAGCAACCTTGCAAACGTTGCCTCGCAGACCAAAGTGGGCGTGGCCGATCTCATCCAGTTCGCTGCTGCACACGCCATCAAGACATGT
CCTGGCGGCCCCATCGTCCCCGTCAAAGTAGGCCGCAAGGACTCCAGCGTGGCAAACGACATTGCCATTCTGCCCAGCGGCTTTGCCCGGGGAGACGACCTGGTCCGGCTATTTG
GATCC
AAGGGGTTCTCGCCCGTCGACCTTTCCGCTCTCATCGGCGCTCACAGCACAGCCAAGCAACAGGGCACCGATCCGGCGCGCGCGGGTGCAGCCCTCGACACCACGCCCGGTGCCTGGGAC
GTCAAGTACTACAGCGAGACGCTTGCGGGAACCGCTCCTTTTACCTTACAGTCTGACAAGAACATTGCACGCAACCCTGCTACGGCCCAGTCCTTCCAGCAATTTGCAAGGAGCCAGGGA
GCGTGGAACGCTGCTTTTGTCCCGGCCATGGTCAAGATGAGCATGATGGGTGTAAATCCCGCTGGCTTGATCGACTGCACGAGCGCGCTTCCTGGCGGTAACAGGAAGAGGGAAGAGGAG
GAGGAGGAGGAGGAGGAGAGGACCATTTTTGGTCGTCTGAGATTCTAG

Retrieve as FASTA