Entry information : OsPrx50(LOC_Os03g55410)
Entry ID 1060
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-10 (Christophe Dunand)
Peroxidase information: OsPrx50(LOC_Os03g55410)
Name OsPrx50(LOC_Os03g55410)
Class Class III peroxidase    [Orthogroup: Prx114]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx50
start..stop
S start..stop
SiPrx160 506 0 9..334 1..326
ZmPrx108 501 2e-180 11..334 5..328
ZmPrx108_35A19 499 8e-180 28..334 24..330
SbPrx03 488 4e-175 9..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31313324..31313560 237 N° 2 31313662..31313856 195 N° 3 31313933..31314098 166 N° 4 31314193..31314599 407
join(31313324..31313560,31313662..31313856,31313933..31314098,31314193..31314599 )


exon

Literature and cross-references OsPrx50(LOC_Os03g55410)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8W5H8
DNA ref. GenBank:   NC_008396.1 (31313348..31314596)
Protein sequence: OsPrx50(LOC_Os03g55410)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (302)
PWM (Da):   %s   35710.74 (32214.9)  
PI (pH):   %s   6.5 (4.98) Peptide Signal:   %s   cut: 25 range:25-326
Sequence 375
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHAKRFNKMARPSSSWWMALLVVAAVAQLGASDLRTDYYNSTCPNVESIVLGVVKDKMQATIRTIGSTVRLFFHDCFVDGCDGSVLITSTAGNTAERDAPDNLSLAFEGFETVRSAKAAVEAACPDQVSCTDVLAIATRDAIALSGGPFFPVELGRLDGMRSSASNVAGKLPQPNNTLSELVAIFKSNGLNMSDMVALSAAHSVGLAHCSKFSDRLYRYNPPSQPTDPTLNEKYAAFLKGKCPDGGPDMMVLMDQATPALFDNQYYRNLQDGGGLLASDELLYTDNRTRPTVDSLAASTPDFYKAFADAIVKLGRVGVKSGGKGNIRKQCDVFN

Retrieve as FASTA  
Remarks chromosome 3. 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCATGCCAAGAGGTTTAACAAGATGGCTCGGCCGTCGTCGTCGTGGTGGATGGCGCTGCTCGTCGTCGCCGCCGTGGCGCAGCTCGGCGCGTCCGACCTGAGGACGGACTACTACAACA
GCACGTGCCCCAACGTCGAGAGCATCGTGCTCGGCGTGGTGAAGGACAAGATGCAGGCCACCATCCGCACCATCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAT
GTAC
AAACACTTTGCTTGATTGATTAATCGGCGATGTGTCAAGCATGGCGATCTCGATTGACTGACGTCGTGTGTGCGGCGTGGCGTGGCGTGGCGTGCAGGGGTGTGACGGCTCGGTGCTGAT
CACGTCGACGGCGGGCAACACGGCGGAGAGGGACGCGCCCGACAACCTCTCGCTGGCGTTCGAGGGATTCGAGACGGTGAGGAGCGCCAAGGCCGCCGTCGAGGCCGCGTGCCCCGACCA
GGTCTCCTGCACCGACGTGCTCGCCATCGCCACGCGCGACGCCATCGCCCTG
GTACGCTACGCGCTACACCAACTCGCACACGCTCTAGAAGTAACCGGTGATGCCAAACACTGCAAGAT
TCGTGCAGAGCGGTGGGCCATTCTTCCCGGTGGAGCTGGGCAGGCTGGACGGCATGAGGTCCAGCGCCAGCAACGTCGCCGGCAAGCTGCCGCAGCCGAACAACACCCTCAGCGAGCTCG
TCGCCATCTTCAAATCCAACGGCCTCAACATGTCTGACATGGTCGCGCTCTCAG
GTGCGACATAGACACACACTATACTATACAAACCAATGCATCCCCCGCCATGTGTTCGACGCAATG
ACTGACCGGACTCGGTGTACGCATGCAGCGGCGCACAGCGTCGGGCTGGCGCACTGCAGCAAGTTCTCGGACCGGCTGTACCGCTACAACCCGCCGTCGCAGCCGACGGACCCGACGCTG
AACGAGAAGTACGCGGCGTTCCTCAAGGGCAAGTGCCCCGACGGCGGGCCGGACATGATGGTGCTCATGGACCAGGCCACGCCGGCGCTCTTCGACAACCAGTACTACCGGAACCTGCAG
GACGGCGGCGGCTTGCTCGCCTCCGACGAGCTGCTCTACACCGACAACCGCACGCGGCCGACGGTGGACTCGCTGGCGGCCAGCACGCCGGACTTCTACAAGGCCTTCGCCGACGCCATC
GTCAAGCTCGGCCGCGTCGGGGTCAAGTCCGGCGGCAAGGGCAACATCCGGAAGCAGTGTGACGTCTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCATGCCAAGAGGTTTAACAAGATGGCTCGGCCGTCGTCGTCGTGGTGGATGGCGCTGCTCGTCGTCGCCGCCGTGGCGCAGCTCGGCGCGTCCGACCTGAGGACGGACTACTACAACA
GCACGTGCCCCAACGTCGAGAGCATCGTGCTCGGCGTGGTGAAGGACAAGATGCAGGCCACCATCCGCACCATCGGCTCCACCGTCCGCCTCTTCTTCCACGACTGCTTCGTCGAT
GGGT
GTGACGGCTCGGTGCTGATCACGTCGACGGCGGGCAACACGGCGGAGAGGGACGCGCCCGACAACCTCTCGCTGGCGTTCGAGGGATTCGAGACGGTGAGGAGCGCCAAGGCCGCCGTCG
AGGCCGCGTGCCCCGACCAGGTCTCCTGCACCGACGTGCTCGCCATCGCCACGCGCGACGCCATCGCCCTG
AGCGGTGGGCCATTCTTCCCGGTGGAGCTGGGCAGGCTGGACGGCATGA
GGTCCAGCGCCAGCAACGTCGCCGGCAAGCTGCCGCAGCCGAACAACACCCTCAGCGAGCTCGTCGCCATCTTCAAATCCAACGGCCTCAACATGTCTGACATGGTCGCGCTCTCAG
CGG
CGCACAGCGTCGGGCTGGCGCACTGCAGCAAGTTCTCGGACCGGCTGTACCGCTACAACCCGCCGTCGCAGCCGACGGACCCGACGCTGAACGAGAAGTACGCGGCGTTCCTCAAGGGCA
AGTGCCCCGACGGCGGGCCGGACATGATGGTGCTCATGGACCAGGCCACGCCGGCGCTCTTCGACAACCAGTACTACCGGAACCTGCAGGACGGCGGCGGCTTGCTCGCCTCCGACGAGC
TGCTCTACACCGACAACCGCACGCGGCCGACGGTGGACTCGCTGGCGGCCAGCACGCCGGACTTCTACAAGGCCTTCGCCGACGCCATCGTCAAGCTCGGCCGCGTCGGGGTCAAGTCCG
GCGGCAAGGGCAACATCCGGAAGCAGTGTGACGTCTTCAACTGA

Retrieve as FASTA