Entry information : EcamRboh04 (EcC047485.20)
Entry ID 10607
Creation 2012-02-29 (Qiang Li)
Last sequence changes 2012-02-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-21 (Christophe Dunand)
Peroxidase information: EcamRboh04 (EcC047485.20)
Name (synonym) EcamRboh04 (EcC047485.20)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamRboh04
start..stop
S start..stop
EgrRboh04 1847 0 1..889 1..889
EglRboh04 1845 0 1..889 1..889
EguRboh04 1781 0 1..889 1..889
AgluRboh03 1502 0 1..889 1..883
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..511 511 N° 2 732..891 160 N° 3 1006..1054 49 N° 4 1165..1278 114
N° 5 1445..1879 435 N° 6 2021..2407 387 N° 7 2508..2603 96 N° 8 2734..2849 116
N° 9 2961..3063 103 N° 10 3248..3321 74 N° 11 3467..3981 515 N° 12 4120..4229 110
join(1..511,732..891,1006..1054,1165..1278,1445..1879,2021..2407,2508..2603,2734 ..2849,2961..3063,3248..3321,3467..3981,4120..4229)


exon

Literature and cross-references EcamRboh04 (EcC047485.20)
Protein sequence: EcamRboh04 (EcC047485.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   889
PWM (Da):   %s   100967.6 Transmb domain:   %s   o340-359i480-502o522-544i704-721o
PI (pH):   %s   9.28
Sequence 930
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIQDHHQHAQWSDTDSNCSSRLGYSGPLSSMSTKIRSNARFRDDQDEECYVEITLDVGEDSVSVHDIKGGGDPETALFTSRLGLRPSSLGAQLSFRLRQVSQELRRITSTKGRNNQIDRTRSGAARALRGLQFMTKNVEIDQGWSEVEARFDELAFNGVLPKSLFGQCIGMNESSEFASELFDALARRRGITSSAVSKPELREFWEQIADQSFDARLQTFFDMVDKNADGRITEEEVKEIIALSASANKLSKIQEQAEEYAALIMEELDPSNLGYIELHNLETLLLQAPIQSRSAHAGSESRVLSQMLSQKLVPTREHNPIKRYYKALAYFIEDNWKRIWVMGLWISICAGLFTWKFIQYKHRAVFDVMGYCVTTAKGGAETTKFNMALILLPVCRNTVTWLRSRTRLGVIVPFNDNINFHKVIAWGIAVGVGLHAGAHLTCDFPRLLHATDAEYEPMKQFFGEKRPNNYWWFVKGTEGWTGVSMLVLMIIAYTLAQPWFRRNRLDLPKALKKLTGFNAFWYSHHLFVIVYVLFVIHGYFLYLAKKWYKRTTWMYLAVPVTLYASERLLRALRSGYKTVRIFKVAVYPGNVMALHMSKPQGFRYTSGQYIFVNCAAVSPFQWHPFSITSAPGDDYLSLHIRTVGDWTSQLKAVFSKACQPPSIDQSGLLRADIATGENVPRIPRLLIDGPYGAPAQDYKNYDVLLLVGLGIGATPLISIVKDVLNNIKQQKEMEKGIVESGAKSNKRKPFLTRRAYFYWVTREQGSFEWFRGVMNEVAENDRDGVIELHNYCTSVYEEGDARSALIAMLQSLNHAKNGVDIVSGTRVRTHFARPNWRNVFKHVAVNHPGERVGVFYCGVQGVVGEMRRLAQDFSHKTTTKFYFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa. Close to EcC013027.80 on a short contig (Removed) and EcC045336.10 (Removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGATCCAAGATCATCACCAGCATGCTCAGTGGTCTGACACAGACAGCAATTGTAGCTCCAGACTTGGTTATAGTGGCCCTCTGAGTAGCATGAGCACCAAGATCAGAAGCAATGCAA
GATTCAGGGACGACCAAGATGAGGAATGCTACGTCGAGATCACGCTAGATGTTGGCGAAGATAGCGTCTCGGTTCACGACATTAAGGGAGGAGGAGATCCTGAGACAGCATTGTTCACGA
GTCGCTTGGGGCTGCGGCCCTCATCGCTCGGTGCACAGCTGTCGTTCAGGCTCAGACAAGTCTCGCAAGAGCTCAGGCGAATCACCTCGACGAAAGGGCGTAATAATCAGATCGATAGGA
CTAGATCCGGTGCTGCACGGGCATTGCGTGGGCTCCAGTTTATGACCAAGAATGTCGAGATCGATCAAGGTTGGTCTGAGGTTGAAGCAAGGTTCGATGAATTGGCTTTTAATGGAGTTC
TTCCGAAATCACTCTTCGGCCAGTGTATAG
GTATGTCAACTGATTTTGCTAAAAAGAAATGCTAGAATCGAATACTTAATTCATATAAACAATGTTAGTTGTTTCAAACGGAAAGATCTG
CATTTATTACATTGTTTCATCTCAAGAATATTCTGTCAACTCATTTAGTCCTTCGATACATTTCTTAGATATTAGTGAACTTGCATTAAATTAGAGTAGCGGACTGACAAGGATCGTTGC
ATCTGTTCAGGGATGAATGAATCCAGTGAGTTTGCCAGCGAGCTATTTGACGCGCTGGCACGACGGAGAGGCATAACATCGTCTGCAGTAAGCAAGCCTGAGCTACGGGAATTCTGGGAA
CAGATTGCAGATCAAAGCTTCGATGCGAGGTTGCAAACCTTCTTCGATAT
GTAAGTTCACATGCCCATTTCACTATAATAGCTTTCACATTGAATCAACTAAAAAATGGGGCTTACTTGG
GACTTATTCAGACAGATCCATTGAGAAGTTATTTAATGATGCAGGGTAGACAAAAATGCAGATGGTCGGATCACCGAGGAAGAGGTGAAAGAGGTAAGAGATGGTCAAGAAAAGAATATG
ATGATGATGATGATGAGGAATGATTCAATGTGAGAGAATAATTACTAAGTTACTAATTGTGATCATATCATTGTCAACATCAGATAATTGCACTAAGCGCTTCAGCGAATAAGCTGTCAA
AGATCCAAGAACAAGCTGAGGAATATGCAGCCTTGATCATGGAAGAGTTGGATCCTAGTAATCTGGGATACATTGAG
GTACATGTTCAGATCCAAACCTTCGACTTTTTAAATGATTGTT
GACCACATGACTCACGTACCGTGCTTACTAATATTCAATTACTTATCTAAGATATTGCCTTGATTTAAAAGTCTAAATTGAGTCAAGTACCTGAGAAGAGCATCTGCTGAACTCCTGTTT
TAGCTACACAACCTGGAGACACTCCTCTTGCAAGCCCCGATCCAATCAAGGTCGGCCCACGCCGGGTCTGAGAGCCGGGTCCTGAGCCAGATGCTGAGCCAGAAGCTGGTCCCAACCAGA
GAGCACAACCCCATCAAGAGATACTACAAGGCACTGGCCTACTTCATTGAGGACAATTGGAAGAGGATTTGGGTCATGGGCCTATGGATCTCAATCTGTGCAGGCCTGTTCACTTGGAAG
TTCATCCAGTACAAGCACAGAGCCGTGTTTGATGTGATGGGCTACTGTGTGACCACAGCTAAAGGTGGAGCTGAGACTACCAAGTTCAACATGGCCCTGATTTTGCTTCCAGTTTGCAGA
AACACAGTCACTTGGCTGAGGAGTAGAACCAGGTTGGGTGTGATTGTTCCCTTCAATGACAACATCAATTTCCACAAG
GTATGAACATATTATGCTGCGGCAAATTTAGTTGAAAAGGGT
ATTTGGATATGCGTTGAAGGAAAAATTGAAAGAGAACATAATTTACTTCACTAAGCACTTAATCTAATTATAAGCGTTAAATGTATGTGGCCTAAATAGGTGATAGCTTGGGGCATTGCG
GTTGGGGTTGGTCTGCATGCCGGAGCCCATCTGACCTGCGACTTCCCTAGGCTGCTCCATGCCACCGATGCTGAATACGAGCCAATGAAGCAGTTCTTCGGCGAGAAGCGCCCCAATAAC
TACTGGTGGTTCGTGAAAGGGACTGAGGGCTGGACCGGTGTGTCCATGCTGGTGCTGATGATCATAGCGTACACCTTAGCCCAGCCCTGGTTCCGCCGTAACCGGCTGGACCTCCCCAAG
GCCCTCAAAAAGCTCACCGGGTTCAATGCTTTTTGGTACTCGCACCACCTCTTTGTGATCGTCTACGTGCTCTTCGTGATACACGGCTACTTCTTGTATTTAGCCAAGAAGTGGTACAAG
AGAACA
GTGAGTGATAATCTACATCATATTGCTTAGTAATTAATGAGATATTTACAGTTTGTCCAATGTCACATTTCTAACTATGTCTACGAACTCGTTTGCGCAGACCTGGATGTATCT
TGCAGTACCAGTGACATTATATGCGTCCGAGCGCTTGCTCCGTGCGCTCAGGTCCGGGTACAAGACTGTGCGGATCTTCAAG
GTGAGGCAGATTCGATTAAGAGTTGTTCTGTTTTGAAA
CACTGCAGAATAGTTGTCCAGACTGATGTTTTAAACACGAGGCATTCACAATCACAATAACTGAGTTGGGGTCATATTCTGGTGCGTTTCAGGTTGCAGTTTATCCAGGAAATGTCATGG
CTCTGCACATGTCTAAGCCTCAAGGCTTCAGATACACAAGCGGTCAATACATTTTTGTGAACTGTGCAGCTGTTTCTCCATTCCAATG
GTAACTTTTATTTTTTAACAAAAAAGACAGAG
GAAAATGATTACTTCTGTACATTACTTGTATTAGCCATTGAAAAGGAACTTGGCTAACTGGTCAGTTGAACATCATCAGGCATCCATTTTCGATCACCTCAGCACCCGGCGACGATTACT
TAAGCCTTCATATACGCACCGTGGGCGACTGGACATCTCAGCTTAAAGCTGTATTCTCGAAG
GTGATTGTTCGAGTTTATTTCTAAGTAACTTTGCGACATACTTGGTCCTGCCTATTGG
CAACCGATTGTGAGAAATCTTCTGAACTTAAGTAAGGTCCGCATCAGTCTAATTACGACATGCTGTCGTATGGATGTATATGCTCTTTAAAAACATGACGAAAAGTCACATTGTGAATGT
GTGTAGGCATGTCAACCTCCATCAATTGATCAAAGTGGACTTCTAAGAGCAGATATCGCAACAGGAGAAAATGTACCCAGGTAATTAGACTGTTCGCGCAACTCATGGTCTGCTCGGCTC
GCTAGGCTTGAAGTCTAGATGAGTAGTTTCAGGGAACACGAACATAGCGTATACAGTTTTTCGTAGAATGGGCAAGCAAGCTAATTGGATATCATTTTCATCTAGGATTCCGAGGCTCTT
GATCGACGGTCCATATGGTGCTCCAGCACAAGACTACAAGAATTACGACGTGCTTCTCCTAGTCGGGCTTGGCATCGGTGCGACACCATTGATCAGCATCGTCAAGGACGTCCTCAACAA
CATCAAGCAGCAGAAAGAGATGGAAAAGGGCATCGTAGAGAGCGGCGCCAAGAGCAACAAGCGAAAGCCGTTCCTGACCCGGCGGGCCTACTTCTACTGGGTCACCCGTGAGCAGGGCTC
GTTCGAGTGGTTCAGAGGCGTGATGAACGAGGTCGCCGAGAACGACAGGGACGGCGTGATCGAGCTCCACAACTACTGCACCAGCGTGTACGAGGAGGGCGACGCCCGGTCGGCCCTGAT
CGCGATGCTCCAGTCCCTGAACCACGCCAAGAACGGGGTCGACATCGTGTCGGGCACCCGGGTACGGACGCACTTCGCGAGGCCCAACTGGCGCAACGTCTTCAAGCATGTCGCGGTCAA
CCACCCCGGCGAAAGAGTTG
GTGAGCATCCTAAAGCACGTCTAGCACATATTTTCCAGGAAGCATAGACATAATTCACTCCAATAAATGATTAATTATCACATTTTCAGCATCTACTCGT
GAGTCGACTAATGTCAAGATGTTTCCTTTCTTCTACAGGAGTGTTTTATTGTGGCGTACAAGGGGTGGTTGGGGAGATGAGGAGGTTGGCTCAGGACTTCTCCCACAAGACCACCACCAA
GTTCTATTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGATCCAAGATCATCACCAGCATGCTCAGTGGTCTGACACAGACAGCAATTGTAGCTCCAGACTTGGTTATAGTGGCCCTCTGAGTAGCATGAGCACCAAGATCAGAAGCAATGCAA
GATTCAGGGACGACCAAGATGAGGAATGCTACGTCGAGATCACGCTAGATGTTGGCGAAGATAGCGTCTCGGTTCACGACATTAAGGGAGGAGGAGATCCTGAGACAGCATTGTTCACGA
GTCGCTTGGGGCTGCGGCCCTCATCGCTCGGTGCACAGCTGTCGTTCAGGCTCAGACAAGTCTCGCAAGAGCTCAGGCGAATCACCTCGACGAAAGGGCGTAATAATCAGATCGATAGGA
CTAGATCCGGTGCTGCACGGGCATTGCGTGGGCTCCAGTTTATGACCAAGAATGTCGAGATCGATCAAGGTTGGTCTGAGGTTGAAGCAAGGTTCGATGAATTGGCTTTTAATGGAGTTC
TTCCGAAATCACTCTTCGGCCAGTGTATAG
GGATGAATGAATCCAGTGAGTTTGCCAGCGAGCTATTTGACGCGCTGGCACGACGGAGAGGCATAACATCGTCTGCAGTAAGCAAGCCTG
AGCTACGGGAATTCTGGGAACAGATTGCAGATCAAAGCTTCGATGCGAGGTTGCAAACCTTCTTCGATAT
GGTAGACAAAAATGCAGATGGTCGGATCACCGAGGAAGAGGTGAAAGAGA
TAATTGCACTAAGCGCTTCAGCGAATAAGCTGTCAAAGATCCAAGAACAAGCTGAGGAATATGCAGCCTTGATCATGGAAGAGTTGGATCCTAGTAATCTGGGATACATTGAG
CTACACA
ACCTGGAGACACTCCTCTTGCAAGCCCCGATCCAATCAAGGTCGGCCCACGCCGGGTCTGAGAGCCGGGTCCTGAGCCAGATGCTGAGCCAGAAGCTGGTCCCAACCAGAGAGCACAACC
CCATCAAGAGATACTACAAGGCACTGGCCTACTTCATTGAGGACAATTGGAAGAGGATTTGGGTCATGGGCCTATGGATCTCAATCTGTGCAGGCCTGTTCACTTGGAAGTTCATCCAGT
ACAAGCACAGAGCCGTGTTTGATGTGATGGGCTACTGTGTGACCACAGCTAAAGGTGGAGCTGAGACTACCAAGTTCAACATGGCCCTGATTTTGCTTCCAGTTTGCAGAAACACAGTCA
CTTGGCTGAGGAGTAGAACCAGGTTGGGTGTGATTGTTCCCTTCAATGACAACATCAATTTCCACAAG
GTGATAGCTTGGGGCATTGCGGTTGGGGTTGGTCTGCATGCCGGAGCCCATC
TGACCTGCGACTTCCCTAGGCTGCTCCATGCCACCGATGCTGAATACGAGCCAATGAAGCAGTTCTTCGGCGAGAAGCGCCCCAATAACTACTGGTGGTTCGTGAAAGGGACTGAGGGCT
GGACCGGTGTGTCCATGCTGGTGCTGATGATCATAGCGTACACCTTAGCCCAGCCCTGGTTCCGCCGTAACCGGCTGGACCTCCCCAAGGCCCTCAAAAAGCTCACCGGGTTCAATGCTT
TTTGGTACTCGCACCACCTCTTTGTGATCGTCTACGTGCTCTTCGTGATACACGGCTACTTCTTGTATTTAGCCAAGAAGTGGTACAAGAGAACA
ACCTGGATGTATCTTGCAGTACCAG
TGACATTATATGCGTCCGAGCGCTTGCTCCGTGCGCTCAGGTCCGGGTACAAGACTGTGCGGATCTTCAAG
GTTGCAGTTTATCCAGGAAATGTCATGGCTCTGCACATGTCTAAGCCTC
AAGGCTTCAGATACACAAGCGGTCAATACATTTTTGTGAACTGTGCAGCTGTTTCTCCATTCCAATG
GCATCCATTTTCGATCACCTCAGCACCCGGCGACGATTACTTAAGCCTTCATA
TACGCACCGTGGGCGACTGGACATCTCAGCTTAAAGCTGTATTCTCGAAG
GCATGTCAACCTCCATCAATTGATCAAAGTGGACTTCTAAGAGCAGATATCGCAACAGGAGAAAATGTAC
CCAG
GATTCCGAGGCTCTTGATCGACGGTCCATATGGTGCTCCAGCACAAGACTACAAGAATTACGACGTGCTTCTCCTAGTCGGGCTTGGCATCGGTGCGACACCATTGATCAGCATCG
TCAAGGACGTCCTCAACAACATCAAGCAGCAGAAAGAGATGGAAAAGGGCATCGTAGAGAGCGGCGCCAAGAGCAACAAGCGAAAGCCGTTCCTGACCCGGCGGGCCTACTTCTACTGGG
TCACCCGTGAGCAGGGCTCGTTCGAGTGGTTCAGAGGCGTGATGAACGAGGTCGCCGAGAACGACAGGGACGGCGTGATCGAGCTCCACAACTACTGCACCAGCGTGTACGAGGAGGGCG
ACGCCCGGTCGGCCCTGATCGCGATGCTCCAGTCCCTGAACCACGCCAAGAACGGGGTCGACATCGTGTCGGGCACCCGGGTACGGACGCACTTCGCGAGGCCCAACTGGCGCAACGTCT
TCAAGCATGTCGCGGTCAACCACCCCGGCGAAAGAGTTG
GAGTGTTTTATTGTGGCGTACAAGGGGTGGTTGGGGAGATGAGGAGGTTGGCTCAGGACTTCTCCCACAAGACCACCACCA
AGTTCTATTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA