Entry information : OsPrx53(LOC_Os04g04750)
Entry ID 1063
Creation 2006-08-28 (Filippo Passardi)
Last sequence changes 2006-08-28 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-10 (Christophe Dunand)
Peroxidase information: OsPrx53(LOC_Os04g04750)
Name OsPrx53(LOC_Os04g04750)
Class Class III peroxidase    [Orthogroup: Prx072]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer Glomus intraradices infection
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx53
start..stop
S start..stop
OsiPrx53 656 0 1..338 1..338
BdiPrx81 423 2e-149 5..338 2..341
OsiPrx66 407 3e-143 31..338 39..342
OsPrx66 407 7e-143 31..338 42..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2271936..2272127 192 N° 2 2269010..2269834 825  
complement(join(2269010..2269834,2271936..2272127))


exon

Literature and cross-references OsPrx53(LOC_Os04g04750)
Literature REFERENCE 1. Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
REFERENCE 2. Guimil S., Chang H-S., Zhu† T., Sesma A., Osbourn A., Roux C., Ioannidis V, Oakeley E J., Docquier M., Descombes P., Briggs† S P., and Paszkowsk U. Comparative transcriptomics of rice reveals an ancient pattern of response to microbial colonization, 102 (22), 8066–8070 (2005)
Protein ref. UniProtKB:   Q7XLT4   A2XPZ4 [Incorrect splicing]   Q5U1P0 [Incorrect splicing]
DNA ref. GenBank:   NC_008397.1 (2272127..2269013)
Cluster/Prediction ref. UniGene:   Os.86533
Protein sequence: OsPrx53(LOC_Os04g04750)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (312)
PWM (Da):   %s   35630.18 (33083.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.46 (5.06) Peptide Signal:   %s   cut: 27 range:27-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLTRALAGAAVLSLCLLLAVQPAAAAGGKVESTVRKEVVKAIRADPSVGPALIRLVFHDCWVNGCDGSVLLDTTPFNSSAGVEKAAANNIGLRGFDVIDAIKAKLGDAVSCADIVVLAGRDATTILSRGRITYAVETGRKDGVVSSAAAADATLPESTFDIDQLTGNFARKNFTAEELVALAGAHAVGVSHLSSFRDRINATTETPINPRYQAALAGDVETLKGRQNATDPIEKFNIRDMDAGFRNASGFDAAGVDMAAVGVLDNSFYHANLQNMVLLRSDWELRNGTDPSLGDSLFAFRENATVWEMEFAAAMAKLSVLPAEGTRFEMRKSCRATN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1). No ESTs (NIAS DNA database and TIGR). Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTTACTCGCGCGTTGGCCGGCGCCGCCGTGCTATCACTATGCTTGTTGCTCGCCGTGCAGCCGGCGGCGGCGGCCGGCGGCAAGGTGGAGAGCACGGTGAGGAAGGAGGTGGTG
AAGGCCATCAGAGCCGATCCCAGCGTTGGCCCCGCCCTCATTCGCTTGGTGTTCCACGACTGCTGGGTCAAT
GTATGTAGTGTTTCCGTTTTTCCTTTAAATTAATTTTTGGTTTGATGA
GTAATTTTCGTAAAACGCCCTATCTGTTATAGTCCAAGTTACACAAAATCACAGGAATTTTGTTATGTGGCACGTAACCTCGGGTATTATCATCCTAAAGTTTTACAAAGTCACACGATC
ATTTTGATTTTGGTTTACCACACTTTTGAGTTCTACGATCGTATCTTAAATTTATAAGGATTTCATCCATCGTATAAATGCTACGTTTGCTTTTAAATTTTGATATATGAGTATGTCAAA
ATGGTTAACGGTATCATTTGAGGAAAAATATATAATGCAAACCATAAATATAATGGAAACCTAGAAACTATCGTTAGATAAAAAAATGGACGTTTGAGATTTGTCCACGTTACCAAGGAT
AAATATTTTACTTTAATTCATGATTAAATGTAGGAGTGAACTTTTACTCTTAGTGACATAGACATATCTCAGATTTCATATTTGGATCCAATGGTGGTTTTTATATTCCCAGTGCATATG
TAGTTCACACTACATATTTTCCCTGGTTTTGTGAAACTTTAGGATCATAGTATTAGGGGTTATGTAATATGTGTTAAAATTCTTATGGTTTTTGTGTAACTTAAACCATAATATGTGGAG
TTTTATGAACTATAATTTTAGTTATATATGCCTATGAACCTCAAGCATATGCTTAGGTACATTATAATTGTTTTCATATTCGTACGGTTCACTGAATTATATAGCTTTTCTTTTCAAGTA
GCTTGATGGATGCATTGTTGTTTCACGTGATTAAAATGATAAAGAAAATGTGAGTTCTTCAGTTTTGGTTGATAAATGACTTGCACTAATCCTAGAAATGCAACGATAAACAGTGGTGGA
GCGCAATTAGGTCTTGTTTTTTTCTCCAACAAGAGTTGGATTAAGATTAAGATTTTCGTGATACGCTTTTCAAACTACTATACGGTGTGTTTCGTGCAAGTACTTTATATATGAAAGTTG
GTCTAAAATATCATATTAATCTATTTTTCAAGTTTGTAATAATTAAAACTTAATCAATCATACGTTAATACCACCTCGTCTTGCGTAAAAAACTTAATTTTTATCTTCATCTTCAGGACA
AAAGAACAGCACCTTAGTTTGTTTTAGCGTTTGTCATGGATGAATATGACACATCATGCAATCGAGAAAGCATATGCATGAGTTTTCTGGTTTAGAGCAAACCGGCCCATTCTCATAGAT
GGGCCGAAAATCTGACCTAAATTAATTTATGGCCCATCCATAGTTTGCTTAACAACACAGTTTATCTCTACTATATATATATTAAAAGCAGATATATCCCCTTTCCATTTCCCTCCTAAC
ATGCACAGCGTGTGCTTGTACGCAAAAAACAACCATTGTCGCTACATAATTATGTGTGTTTGGTCTAGTGATTACAATTTCGGTCCGAAATTTAAGAAATTTTAGACCCGTGCAAGTCAC
TATATCTCGACCGAAATTTTTCTATATTTGGTCAAAATTTAATCAAATTCAATTACATTGTGTTAAAATTTTAGAAAAGTGCCTAAAATCCCGAAATTTCGGTTCTACCGAAACTAAGAT
GGATTTGCTGAAAAAGTGTCGCCACATTATGTGGCTGAGTACAGTCGAATTTTAACGGCTGGGATGCACTGCGCTGGACATCGTGTGCACGATGCACATCCGTTTCTCCACCTGTTTATC
CCTTTGCAATTTTTTTACTTTATTTGTTGATCCGGAATTGCTATGGGTTTGTAGCAGTCAATTTTGTTGTTGTAATTATGTATTTATACAAATTTACATACTAGTTACACTCCACTTACA
CATCACTTACATATGTAATTTTAAGACCTATATATGTAATTATATGTAATTTTAGGACTTACATTGTAAATATACTAAAATTACATATGTAATTTAGAGATTTACAATGTAAATACATAC
CGACTATTTTTTGATGAAAAATATGACGCCATAAATATAGCTAGTAGATCCCTGCTTTAGTCTATTTTTAAATATATATAGGTCTAACTCGTTACAATATACATGCATATAACTAGCGTA
ATGAAAAATGCAGGGATGTGACGGGTCCGTGCTCTTGGACACGACGCCGTTCAACAGCAGCGCCGGCGTCGAGAAGGCGGCGGCGAACAACATCGGCCTCCGCGGCTTCGACGTGATCGA
CGCCATCAAGGCCAAGCTCGGCGACGCCGTCTCCTGCGCCGACATTGTCGTGCTCGCCGGGCGCGACGCCACCACCATCCTGAGCCGCGGCAGGATCACCTACGCCGTCGAGACCGGCCG
CAAGGACGGCGTCGTGTCGTCCGCCGCCGCCGCCGACGCCACCCTCCCGGAGTCCACCTTCGACATCGACCAGCTCACGGGCAACTTCGCCCGGAAGAACTTCACCGCGGAGGAGCTCGT
CGCCCTCGCCGGCGCGCACGCCGTCGGCGTCAGCCACCTCTCCTCCTTCCGCGACCGCATCAACGCCACCACCGAGACCCCGATCAACCCGAGGTACCAGGCGGCGCTCGCCGGCGACGT
CGAGACCCTGAAGGGGCGGCAGAACGCGACGGACCCAATCGAGAAGTTCAACATCCGCGACATGGACGCCGGGTTCCGGAACGCGTCGGGGTTCGACGCCGCCGGCGTGGACATGGCGGC
TGTGGGCGTGCTCGACAACAGCTTCTACCACGCCAACCTGCAGAACATGGTGCTGCTCAGGTCCGACTGGGAGCTGAGGAATGGCACCGATCCGTCGCTCGGCGACAGCCTGTTCGCGTT
CAGGGAGAACGCCACCGTGTGGGAGATGGAGTTCGCCGCCGCCATGGCCAAGCTCAGCGTGCTCCCCGCGGAGGGGACCCGTTTCGAGATGAGGAAGAGCTGCAGGGCTACCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTTACTCGCGCGTTGGCCGGCGCCGCCGTGCTATCACTATGCTTGTTGCTCGCCGTGCAGCCGGCGGCGGCGGCCGGCGGCAAGGTGGAGAGCACGGTGAGGAAGGAGGTGGTG
AAGGCCATCAGAGCCGATCCCAGCGTTGGCCCCGCCCTCATTCGCTTGGTGTTCCACGACTGCTGGGTCAAT
GGATGTGACGGGTCCGTGCTCTTGGACACGACGCCGTTCAACAGCAGC
GCCGGCGTCGAGAAGGCGGCGGCGAACAACATCGGCCTCCGCGGCTTCGACGTGATCGACGCCATCAAGGCCAAGCTCGGCGACGCCGTCTCCTGCGCCGACATTGTCGTGCTCGCCGGG
CGCGACGCCACCACCATCCTGAGCCGCGGCAGGATCACCTACGCCGTCGAGACCGGCCGCAAGGACGGCGTCGTGTCGTCCGCCGCCGCCGCCGACGCCACCCTCCCGGAGTCCACCTTC
GACATCGACCAGCTCACGGGCAACTTCGCCCGGAAGAACTTCACCGCGGAGGAGCTCGTCGCCCTCGCCGGCGCGCACGCCGTCGGCGTCAGCCACCTCTCCTCCTTCCGCGACCGCATC
AACGCCACCACCGAGACCCCGATCAACCCGAGGTACCAGGCGGCGCTCGCCGGCGACGTCGAGACCCTGAAGGGGCGGCAGAACGCGACGGACCCAATCGAGAAGTTCAACATCCGCGAC
ATGGACGCCGGGTTCCGGAACGCGTCGGGGTTCGACGCCGCCGGCGTGGACATGGCGGCTGTGGGCGTGCTCGACAACAGCTTCTACCACGCCAACCTGCAGAACATGGTGCTGCTCAGG
TCCGACTGGGAGCTGAGGAATGGCACCGATCCGTCGCTCGGCGACAGCCTGTTCGCGTTCAGGGAGAACGCCACCGTGTGGGAGATGGAGTTCGCCGCCGCCATGGCCAAGCTCAGCGTG
CTCCCCGCGGAGGGGACCCGTTTCGAGATGAGGAAGAGCTGCAGGGCTACCAACTAA

Retrieve as FASTA