Entry information : PinvKat02
Entry ID 10639
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-11 (Catherine Mathe)
Peroxidase information: PinvKat02
Name PinvKat02
Class Catalase    [Orthogroup: Kat003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvKat02
start..stop
S start..stop
SbreKat02 934 0 1..530 1..530
SlutKat02 925 0 1..530 1..530
PinvKat03 724 0 164..530 1..367
PcKat02 571 0 33..530 25..527
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 207605..207789 185 N° 2 207480..207549 70 N° 3 207387..207422 36 N° 4 207134..207333 200
N° 5 207054..207084 31 N° 6 206950..207001 52 N° 7 206846..206898 53 N° 8 206786..206795 10
N° 9 206702..206736 35 N° 10 206599..206642 44 N° 11 206469..206537 69 N° 12 206239..206420 182
N° 13 206161..206184 24 N° 14 206051..206111 61 N° 15 205950..206001 52 N° 16 205838..205898 61
N° 17 205741..205784 44 N° 18 205663..205687 25 N° 19 205415..205605 191 N° 20 205188..205355 168
complement(join(205188..205355,205415..205605,205663..205687,205741..205784,2058 38..205898,205950..206001,206051..206111,206161..206184,206239..206420,206469..2 06537,206599..206642,206702..206736,206786..206795,206846..206898,206950..207001 ,207054..207084,207134..207333,207387..207422,207480..207549,207605..207789))


exon

Literature and cross-references PinvKat02
DNA ref. JGI genome:   scaffold_13 (207789..205188)
Cluster/Prediction ref. JGI gene:   76475
Protein sequence: PinvKat02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   531 (511)
PWM (Da):   %s   60006.72 (57878.6)  
PI (pH):   %s   5.76 (5.59) Peptide Signal:   %s   cut: 20 range:20-530
Sequence 572
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRVFTFATLLFSGISSVSATAAGAKRDASKAYFDIYQGPNEQDSIINDPSTQHEYTLSGGQPYPNPYMSDRLGTTGPLLIQSTNLIEQLAHFVRERVPERTVHAKGGGAHGYFEVTTSTAMNYSMAKVFDTVGKRTPVTGRFSTIAGNLGNPDTVRDLRGLAFKLRTEDGILDWVFLNHPVFWFRDPAKFPHFIHSQKRNPQTNLLDKNNFWDYLSANNESIYQVMRTMSDLGTPYGFRHMNGFSGNAFRAVKADGSWVYIKISAYTDQGIKNNTNDEAIVQAGVNPDFGVQDLFDAIEAGDYPSWTIYWQVLTPQEAENFKYNIFDLTKEWLTEDVPLQEIGRITFVQNPFNHFSEVEQIGFDPAQLPNGLEPSEDPVLQARLFAYADAQRYRIGVNHKQLPINCPLNPVANFLRDGAMSFNNQGKRPNFWSQQDLLNLEVRPYNDDNHTIWVGGAVKYVSTPTEQDFELPRIFWNSLSEQDQNNLIYNAIWHMGQASDMDIRRKQCKIFQHVNETLGQAIAKGVNVTL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (19 introns). Prediction of the 3' end need to be verified.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGTTTTCACTTTCGCTACTCTTCTGTTCTCAGGGATCTCGTCGGTGTCTGCAACGGCTGCAGGCGCCAAGCGCGACGCAAGCAAGGCATATTTTGATATCTACCAGGGCCCAAAT
GAGCAAGATTCGATCATAAATGACCCATCCACTCAGCACGAATACACCCTGTCTGGAGGGCAGCC
GTCAGCATTGAACTCATCTCTCTTTACAAGTCAACAATTCATGCTGGCTACCTAG

GTACCCAAACCCGTATATGTCGGATAGGCTGGGTACCACCGGTCCCCTGCTAATCCAATCTACTAATCTG
GTACCCACTTTGTCTCGTCCCCACACCCAATCTTTTTCCTCATCCGTGTT
GTTCCAGATTGAGCAGTTGGCACACTTTGTTAGGGAGCGGGTTGTAAGTATTTATTCTAGGCGTCTTCCGCCCTTACTTACCTTCTTTCCATCAAGCCGGAGCGCACTGTTCATGCCAAG
GGCGGAGGTGCTCATGGTTATTTCGAAGTCACCACGTCCACCGCAATGAACTACAGCATGGCGAAGGTGTTCGACACCGTCGGAAAGCGCACTCCTGTGACTGGGCGGTTCTCGACCATT
GCTGGAAACCTTGGAAATCCGGACACGGTTCGAGACCTTCGAGGTCTTGCCTTCAA
GTATGTCCCAAATAAGTAACACCGTTTCTAACGCCTAATGTTGTGCTAGGCTGCGAACTGAGGA
TGGAATTCTCGACTGG
GTGAGCTTGTTTTTTCCATGTCAGATGCCCATCGGAACTCAATCTTGTCAAGGTCTTCCTGAACCACCCTGTGTTCTGGTTTCGTGATCCTGCCAAGTTCCCAC
GTAAGTACGAACACTCACTCACTGCCTCCTGCAGTTGACTACGGACTTCAGACTTCATTCATTCTCAGAAGCGCAACCCCCAAACAAACTTGCTTGACAAAAATGTAAGAATTTCCAATC
AAGCCACAGGAACGATTGTTGACTTGCTCTGCAGAATTTCTGGGGTATGTACCACGAACCCGCTCCCACTCACCTCCTGATGTCCCAGGACAGACTACTTGTCCGCAAACAATGAGTCAA
TATACCAG
GTCAGTACCTTACTGCGACACGTATAGCCATTGCACATGCTAATGCCCAGCCCATGCAGGTTATGCGCACAATGTCTGATTTGGGCACGCCATACGGATTCAGGTGAGTTTA
CCCAGATCAGCGGTGCTGTGCGTAACAGGGTCCTTATTTCACACCACGACAGGCATATGAATGGTTTCAGCGGCAATGCTTTCCGCGCGGTGAAGGCTGATGGATCGTGGGTCTATATCA
A
GTGCGTATACTCCGATGATTCCGCCGTTCATGACCTGAACTTCCCCAGAATTTCTGCGTACACCGACCAAGGCATCAAGAACAACACGAACGACGAAGCGATCGTACAAGCCGGTGTGA
ACCCCGACTTTGGTGTGCAGGACCTCTTCGATGCCATTGAGGCTGGCGACTACCCCAGCTGGACCATCTATTGGCAGGTCCTGACTCCCCAAGAAGCTGAAAACTTCAAAT
GTGAGACAC
TTGATTCATGTGAGATTCGCGGCTAACCTGGTTCATGGGCATCAGACAACATCTTTGATCTCACGAAAGGTACGCATCACGAACCAGCCAAGAGTCTCACAGACTCATGAACCGACAGAG
TGGTTGACTGAAGACGTACCTCTTCAAGAGATTGGGCGAATCACCTTTGTTCAGAATCC
GTGAGATCATTCGGTGATATTGGGAAGCACGTTGATTTGATTATTCCAGCTTCAATCATTT
CTCTGAGGTGGAGCAGATTGGCTTTGATCCAGCTCAGCTG
GTTTGATTTTCCCTCCCGTTCAATTTCGTCCACTTACAGCTCCTCTTTTAGCCTAATGGACTTGAGCCGAGTGAAGACCC
CGTGCTCCAAGCACGTTTGTTTGCTTACGCTG
GTTTGTTCTCGCCACCTCTACATATATTATTGTTTGGACTTACTCGCCTGCAGATGCGCAGCGCTACCGCATTGGTGTTAACCATAAG
CAACTCCCC
GTACGGATAGATTTTCCCCTACGTTTGCTCTTGTCACTGACACAAATCGTCAGATCAACTGCCCTCTGAATCCCGTTGGTAAGTGACCGATGGGTTTGAGTAGTGGCGATG
AACTCAGACAGCACATTCGACCAGCTAACTTCTTGCGTGATGGTGCCATGAGCTTCAATAACCAAGGCAAACGCCCCAACTTCTGGTCGCAACAAGACCTGCTCAACCTCGAGGTCCGGC
CTTATAACGACGACAATCACACTATCTGGGTTGGCGGTGCCGTCAAGTATGTCAGCACACCTACCGAGCAAGACTTTGAGCTCCCCAGGATATTC
GTGAGTACCAGCTACTGTACGGTTC
CTTGCGCAGTATTGACAATGTTCTGCCGCCACAGTGGAATAGCCTTTCTGAACAAGACCAGAATAACTTGATCTACAATGCTATCTGGCATATGGGCCAGGCTAGTGATATGGATATCCG
CAGGAAGCAGTGCAAGATCTTCCAACATGTGAACGAGACTTTGGGTCAGGCCATTGCGAAGGGCGTGAACGTGACCCTTTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCGTTTTCACTTTCGCTACTCTTCTGTTCTCAGGGATCTCGTCGGTGTCTGCAACGGCTGCAGGCGCCAAGCGCGACGCAAGCAAGGCATATTTTGATATCTACCAGGGCCCAAAT
GAGCAAGATTCGATCATAAATGACCCATCCACTCAGCACGAATACACCCTGTCTGGAGGGCAGCC
GTACCCAAACCCGTATATGTCGGATAGGCTGGGTACCACCGGTCCCCTGCTAATC
CAATCTACTAATCTG
ATTGAGCAGTTGGCACACTTTGTTAGGGAGCGGGTTCCGGAGCGCACTGTTCATGCCAAGGGCGGAGGTGCTCATGGTTATTTCGAAGTCACCACGTCCACCGCA
ATGAACTACAGCATGGCGAAGGTGTTCGACACCGTCGGAAAGCGCACTCCTGTGACTGGGCGGTTCTCGACCATTGCTGGAAACCTTGGAAATCCGGACACGGTTCGAGACCTTCGAGGT
CTTGCCTTCAA
GCTGCGAACTGAGGATGGAATTCTCGACTGGGTCTTCCTGAACCACCCTGTGTTCTGGTTTCGTGATCCTGCCAAGTTCCCACACTTCATTCATTCTCAGAAGCGCAAC
CCCCAAACAAACTTGCTTGACAAAAAT
AATTTCTGGGACTACTTGTCCGCAAACAATGAGTCAATATACCAGGTTATGCGCACAATGTCTGATTTGGGCACGCCATACGGATTCAGGCAT
ATGAATGGTTTCAGCGGCAATGCTTTCCGCGCGGTGAAGGCTGATGGATCGTGGGTCTATATCAA
AATTTCTGCGTACACCGACCAAGGCATCAAGAACAACACGAACGACGAAGCGATC
GTACAAGCCGGTGTGAACCCCGACTTTGGTGTGCAGGACCTCTTCGATGCCATTGAGGCTGGCGACTACCCCAGCTGGACCATCTATTGGCAGGTCCTGACTCCCCAAGAAGCTGAAAAC
TTCAAAT
ACAACATCTTTGATCTCACGAAAGAGTGGTTGACTGAAGACGTACCTCTTCAAGAGATTGGGCGAATCACCTTTGTTCAGAATCCCTTCAATCATTTCTCTGAGGTGGAGCAG
ATTGGCTTTGATCCAGCTCAGCTG
CCTAATGGACTTGAGCCGAGTGAAGACCCCGTGCTCCAAGCACGTTTGTTTGCTTACGCTGATGCGCAGCGCTACCGCATTGGTGTTAACCATAAG
CAACTCCCC
ATCAACTGCCCTCTGAATCCCGTTGCTAACTTCTTGCGTGATGGTGCCATGAGCTTCAATAACCAAGGCAAACGCCCCAACTTCTGGTCGCAACAAGACCTGCTCAACCTC
GAGGTCCGGCCTTATAACGACGACAATCACACTATCTGGGTTGGCGGTGCCGTCAAGTATGTCAGCACACCTACCGAGCAAGACTTTGAGCTCCCCAGGATATTC
TGGAATAGCCTTTCT
GAACAAGACCAGAATAACTTGATCTACAATGCTATCTGGCATATGGGCCAGGCTAGTGATATGGATATCCGCAGGAAGCAGTGCAAGATCTTCCAACATGTGAACGAGACTTTGGGTCAG
GCCATTGCGAAGGGCGTGAACGTGACCCTTTG

Retrieve as FASTA