Entry information : PinvKat01
Entry ID 10640
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PinvKat01
Name PinvKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvKat01
start..stop
S start..stop
SbreKat01 771 0 43..491 52..519
SlutKat01 769 0 43..491 52..519
CcinKat01 700 0 43..494 52..522
LbiKat01 699 0 43..495 52..523
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 172160..172297 138 N° 2 170980..170997 18 N° 3 170600..170929 330 N° 4 170370..170549 180
N° 5 170206..170319 114 N° 6 170005..170154 150 N° 7 169839..169946 108 N° 8 169599..169782 184
N° 9 169419..169544 126 N° 10 169221..169366 146  
complement(join(169221..169366,169419..169544,169599..169782,169839..169946,1700 05..170154,170206..170319,170370..170549,170600..170929,170980..170997,172160..1 72297))


exon

Literature and cross-references PinvKat01
DNA ref. JGI genome:   scaffold_38 (172297..169221)
Protein sequence: PinvKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   498
PWM (Da):   %s   55761.17  
PI (pH):   %s   7.65
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSILVNTSTPCHGLKFILFGIVWLIYNALHHDLNKAGPTQTLYREKRIPERVVHAKGAGAHGYFESTHDLSDITSCKLFTSVGKKARATVRFSTVGGESGSADTARDPRGFAIKLRTEDGNLDWVFNNTPVFFLRDPAKFPHFIHTQKRDPQTHLKDADMFWDYLSQNPESAHQILILFSDRGTPDGYHNMHGYSGHTYKLVKDDGNWVYTQIHLIADGGFKTFDAATAGKLAGENPDYGIQSLFETIEARKYPSWTVYVQTMTPEQAESFRYNVLDLTKVWPHKDYPMRPVGKLVLDENVQNYFAEIEQAAFSPSHTIPYLEPSADPVLQSRLFSYPDTHRHRLGRDGLMAINNQGARPGYQSTIAPLTYLKYKGAINGSPRDYERAAKHETWIGGAFWDLSEVTELDFEQPRALYQNVMNDTDRDHLVSNIAGHLGNVKSPVIKARTLSYFASVDQSLSNHIAEAIGAPNAKPLPVKPVSEAISFRANVNKAVKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGATTCTCGTGAATACTAGCACGCCGTGTCATGGCCTGAAGTTCATACTGTTTGGAATAGTTTGGTTAATCTACAATGCTTTACACCATGATCTCAACAAAGCTGGTCCCACCCAG
ACTTTGTACCGGGAGAAG
GTAGGAGCCTTTCGCGCGAATGCATCTGACTGTGGCTCATTATTTTTAGCAACAGCAGTTTCAGGTTTGAGATACCGCCGAGCGACGGTCGGCATCAAAGTT
TGTACACGATATGGCGCGGTTTTTTTTGGTCCGAGGAGACATCAGGTGGCTTTCGACTCCTTGTTAACTTGGTACCTAAGTCGTCGCACTGTTCTCTCGTTGCCAGAAATGCTGCAGATT
TGATTGCAACAACTTCGAATTCTCTGATCCACGAACGTCAGATGCCTGTTTTCAGCACGTGGATTTCGCGCTGAAACGTGGGAGAACCGGAACAATGCTAGTACCAGCCCCATCGGCGAA
GAGATTACTCATCTCATGTTTCGTCAAAGTGCGCAGCTTGGGACATGAAATTGGCCGATGGCATTGTCGGATCCCGCGTCTAGGCCGCCGTGTCCAGCCGTTTCTCTCCGAAACGGTGGC
ACTGACGGAAAGTTAAGAACATTCATGGAACCCAATTGAATGGCGATGACTCCGTGAAACTTTTGATCCCAACCATTGGGCGCGATTTCTTGGTGATTATTCTGGGAATCTATTCTGTGT
GAATTCACCAGTGTCTGATCCGAGGTGTTGGAGGGTGTTGGAGAATGTTCTTCAGTCTTTCTGCTCACGGTCTGTCTTCCACTTGCATGAGGTGGTGTCATGCGTGGGGAGCGAATTTGA
TAAGGGGGACTCCGTAATGTTGACAGGGCTACGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTGCCCACTTCGATCACGAGCGTATCCCAGAGCGTGTCGT
ACGTTCCAGATGTTCATACAGTATGCTCAGTCCCTGATGACGTACTAGGTACATGCCAAAGGCGCTGGTGCACATGGCTATTTTGAGTCGACCCATGACCTCAGCGACATTACCTCTTGC
AAGCTTTTCACATCAGTTGGCAAGAAAGCGCGCGCCACTGTCCGATTCTCCACCGTCGGTGGTGAGTCTGGATCCGCTGATACGGCCCGTGATCCCCGTGGCTTCGCCATCAAGCTGAGG
ACCGAAGACGGTAACCTCGACTGGGTGTTCAACAACACCCCTGTCTTCTTCCTCAGGGACCCTGCCAAGTTCCCTCACTTCATTCACACTCAAAAGCGTGACCCCCAGACGCACTTGAAA
GATGCTGACATGTTCTGG
GTATGTTCACCATATTCCTTGGGTGCCAAATTCTGACCGTTGCACTACAGGACTACCTCTCCCAAAACCCCGAGTCCGCTCACCAAATTCTTATCCTCTTCT
CTGACCGCGGTACTCCCGATGGTTACCACAACATGCACGGTTACTCGGGCCATACCTACAAACTCGTTAAGGACGACGGCAACTGGGTCTACACTCAGATTCACCTCATCGCTGACGGTG
GCTTCAAG
GTTGGTGTGCCCCATTAATGAGCATTAATGACTATTCATGTGTGTTCCAGACCTTCGATGCCGCCACTGCAGGTAAGCTGGCAGGTGAAAACCCCGACTATGGCATCCAATC
TTTGTTCGAGACCATCGAAGCCCGAAAATACCCGTCGTGGACTGTATATGTT
GTACGTATTTTACTCCTGATCATACGACTTTTCATCAACCTATCGGTTTAGCAAACAATGACCCCCGA
GCAAGCGGAGAGCTTCCGCTACAATGTTCTGGATCTCACCAAGGTCTGGCCCCACAAGGACTACCCCATGCGCCCCGTTGGCAAGCTGGTTTTGGACGAGAACGTTCAGAACTACTTCGC
TGAGATCGAACAG
GTCAGTAGCAACCCTTCTATACCGAAACAATATTTGGGCTGACCAAAACACATCTCAGGCTGCCTTCTCTCCTTCTCACACCATCCCCTACCTCGAGCCTTCTGCCG
ACCCTGTCTTGCAGTCGCGTCTCTTCTCCTACCCAGATACCCACCGCCACCGTCTCGGT
GTAACTACTCTCAAATCCCTGTCAACGCACCTATTGTGCCGGTTGCCAACTTCCAGCGCGA
TGGTCTCATGGCAATTAATAACCAGGGCGCTCGCCCCGGCTACCAGAGTACCATAGCTCCATTGACCTACCTCAAGTACAAGGGCGCCATCAACGGTAGTCCTCGCGATTACGAGCGTGC
GGCTAAGCACGAAACTTGGATTGGTGGTGCTTTCTGGGACTTGAGCGAGGTCACTGAGC
GTCAGTGTTGAAATTCTCTTAGCATTGGGGCCTATTTGACAATTGTTCCTACAGTTGACTT
CGAGCAGCCACGTGCTCTCTACCAGAACGTCATGAACGACACCGACCGTGACCACCTCGTCTCCAACATCGCTGGTCACCTGGGTAATGTCAAGAGCCCTGTGATCAAAGCCAGGACCC
G
TGAGTCTTGAAATGTTGGCCTGATTTTCCTTCATCTCACTGTCATTCGCAGTGTCCTACTTCGCTAGCGTTGACCAGTCGCTCTCCAACCACATCGCGGAGGCAATTGGCGCTCCGAATG
CTAAACCCTTGCCAGTCAAACCCGTGTCTGAGGCCATCAGCTTTCGGGCTAATGTCAACAAGGCTGTGAAGCTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGATTCTCGTGAATACTAGCACGCCGTGTCATGGCCTGAAGTTCATACTGTTTGGAATAGTTTGGTTAATCTACAATGCTTTACACCATGATCTCAACAAAGCTGGTCCCACCCAG
ACTTTGTACCGGGAGAAG
CGTATCCCAGAGCGTGTCGTACATGCCAAAGGCGCTGGTGCACATGGCTATTTTGAGTCGACCCATGACCTCAGCGACATTACCTCTTGCAAGCTTTTCACA
TCAGTTGGCAAGAAAGCGCGCGCCACTGTCCGATTCTCCACCGTCGGTGGTGAGTCTGGATCCGCTGATACGGCCCGTGATCCCCGTGGCTTCGCCATCAAGCTGAGGACCGAAGACGGT
AACCTCGACTGGGTGTTCAACAACACCCCTGTCTTCTTCCTCAGGGACCCTGCCAAGTTCCCTCACTTCATTCACACTCAAAAGCGTGACCCCCAGACGCACTTGAAAGATGCTGACATG
TTCTGG
GACTACCTCTCCCAAAACCCCGAGTCCGCTCACCAAATTCTTATCCTCTTCTCTGACCGCGGTACTCCCGATGGTTACCACAACATGCACGGTTACTCGGGCCATACCTACAAA
CTCGTTAAGGACGACGGCAACTGGGTCTACACTCAGATTCACCTCATCGCTGACGGTGGCTTCAAG
ACCTTCGATGCCGCCACTGCAGGTAAGCTGGCAGGTGAAAACCCCGACTATGGC
ATCCAATCTTTGTTCGAGACCATCGAAGCCCGAAAATACCCGTCGTGGACTGTATATGTT
CAAACAATGACCCCCGAGCAAGCGGAGAGCTTCCGCTACAATGTTCTGGATCTCACCAAG
GTCTGGCCCCACAAGGACTACCCCATGCGCCCCGTTGGCAAGCTGGTTTTGGACGAGAACGTTCAGAACTACTTCGCTGAGATCGAACAG
GCTGCCTTCTCTCCTTCTCACACCATCCCC
TACCTCGAGCCTTCTGCCGACCCTGTCTTGCAGTCGCGTCTCTTCTCCTACCCAGATACCCACCGCCACCGTCTCGGT
CGCGATGGTCTCATGGCAATTAATAACCAGGGCGCTCGCCCC
GGCTACCAGAGTACCATAGCTCCATTGACCTACCTCAAGTACAAGGGCGCCATCAACGGTAGTCCTCGCGATTACGAGCGTGCGGCTAAGCACGAAACTTGGATTGGTGGTGCTTTCTGG
GACTTGAGCGAGGTCACTGAGC
TTGACTTCGAGCAGCCACGTGCTCTCTACCAGAACGTCATGAACGACACCGACCGTGACCACCTCGTCTCCAACATCGCTGGTCACCTGGGTAATGTC
AAGAGCCCTGTGATCAAAGCCAGGACCC
TGTCCTACTTCGCTAGCGTTGACCAGTCGCTCTCCAACCACATCGCGGAGGCAATTGGCGCTCCGAATGCTAAACCCTTGCCAGTCAAACCC
GTGTCTGAGGCCATCAGCTTTCGGGCTAATGTCAACAAGGCTGTGAAGCTATAG

Retrieve as FASTA