Entry information : PinvKat03
Entry ID 10641
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PinvKat03
Name PinvKat03
Class Catalase     [Orthogroup: Kat003]*
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvKat03
start..stop
S start..stop
PinvKat02 724 0 1..367 164..530
SlutKat02 683 0 1..367 164..530
SbreKat02 679 0 1..367 164..530
PcKat02 439 2e-152 1..367 161..527
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2391..2423 33 N° 2 2287..2338 52 N° 3 2183..2235 53 N° 4 2128..2137 10
N° 5 2037..2071 35 N° 6 1934..1977 44 N° 7 1804..1872 69 N° 8 1574..1755 182
N° 9 1483..1506 24 N° 10 1370..1430 61 N° 11 1268..1319 52 N° 12 1155..1215 61
N° 13 1058..1101 44 N° 14 981..1005 25 N° 15 733..923 191 N° 16 506..673 168
complement(join(506..673,733..923,981..1005,1058..1101,1155..1215,1268..1319,137 0..1430,1483..1506,1574..1755,1804..1872,1934..1977,2037..2071,2128..2137,2183.. 2235,2287..2338,2391..2423))


exon

Literature and cross-references PinvKat03
DNA ref. JGI genome:   scaffold_1927 (2423..506)
Cluster/Prediction ref. JGI gene:   93901
Protein sequence: PinvKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367
PWM (Da):   %s   42289.81  
PI (pH):   %s   5.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
RLRTEDGILDWPFLNHPVFWLRDPAKFPHFIHSQKRNPQTNLLDHNNFWDYLSANNESIYQVMRTMSDLGTPYGFRHMNGFSGNTFRAVKADGSWVYIKTSAYTDQGIKNNTNDEAIVQAGVNPDFGVQDLFEAIEAGNYPSWTIYWQIMTHQEAENFKYNVFDLTKEWLIEDVPLQEIGRITLVQNPLNHFSEVEQIGFDPAQLPNGLEPTEDPTLQARLFAYADAQRYRTGINHKQLPINCPLNPVANFLRDGAMSFNNQGKRPNFWSQQNLLNLEVRPYNDDNHTIWVGGAVKYVSTPTEQDFELPRIFWNGLSEQDQNNLIYNVIWHMSQASGMDIRTKQCKIFQHVNETLGQAIAKGVDATL*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Large 5'is missing due to BAC end.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGCTGCGAACTGAAGATGGAATTCTCGACTGGGTGAGCGTGTTTTTCCCACGTCAGATGCCCATCGAAACTCAACCTTGTCAAGCCCTTCCTGAACCACCCTGTGTTCTGGCTTCGTGA
TCCAGCCAAGTTCCCAC
GTAAGTACAAACATTCACTCGCTGCCCCCTTCAGCTGACCGCGGACTTCAGATTTCATTCATTCTCAGAAGCGCAACCCCCAAACGAACTTGCTTGATCACAA
T
GTAAGAATCTCCAATCGACCGGAGCAATTGTTGACCGCTCTGCAGAATTTCTGGGGTATGTACCACGAACCCCGTTCCCGCTCGCCTCGAGGTCCTGATGTCCCCGGAAAGACTACTTG
TCCGCAAACAATGAGTCAATATACCAG
GTCAGCATCTTCCTGCGACACGTATAGCCATTACACATGCTAACGCCCAGCCCATGCAGGTTATGCGCACAATGTCTGATTTAGGCACGCCAT
ACGGATTCAG
GTGAGTTTACCCAGATCAGCGATGCTGTGCGCAACAGGGTCCTTATTTCACACCACGACAGGCATATGAATGGTTTCAGCGGCAACACTTTCCGCGCGGTGAAGGCTGAT
GGATCGTGGGTCTATATCAA
GTGTGTATACTGCGATGATTCCGCCGTTCATTACCTGAACTACCCCAGAACTTCTGCGTACACCGACCAGGGCATTAAGAACAACACCAATGACGAGGCG
ATCGTACAAGCTGGTGTGAACCCCGACTTTGGTGTGCAGGACCTCTTCGAAGCCATTGAGGCTGGCAACTACCCCAGCTGGACCATCTATTGGCAGATTATGACTCATCAAGAAGCTGAA
AACTTCAAGT
GTGAGACCTATGAGTCTATGACTTGATTCGTGTGAGATTTGCGGCTAACCTGATACATGGGCATCAGACAACGTCTTTGATCTCACGAAAGGTACGCATCACGAGCCACC
AACCAAAAGCCTGACAGGCTCATGAACCGACAGAGTGGTTGATTGAAGACGTGCCTCTTCAAGAGATTGGCCGAATCACCCTTGTTCAGAACCCGTGAGATCATTCCATGATAATGGGAA
GCACGTTTATTTAATTATTTTTAGCTTGAATCATTTCTCTGAGGTGGAGCAGATTGGCTTTGATCCAGCTCAGCTGGTTTGACTTTCCCCTCTCGTTCAATTTCGTCCACTTACAGCTTC
TCTTCCAGCCTAATGGACTTGAGCCGACTGAAGACCCTACGCTCCAAGCACGTTTGTTTGCTTACGCTGGTTTGTTCTCGTCACCTCTACATATGTTATTATGTGGACTTACTTGCCTGC
AGATGCCCAGCGCTACCGCACTGGTATTAACCATAAGCAGCTTCCCGTACGATTAGATTCTCCCCTACGTTTCCTCTGTCACTGACATAGATTGCCAGATCAACTGTCCTCTGAATCCCG
TTG
GTAAGTGACCGATGGGCTTGAGTAGTGGCGACGCACTCAAACCGCACATTTGATCAGCCAACTTCTTGCGTGATGGTGCCATGAGCTTCAACAACCAGGGCAAACGCCCCAACTTCT
GGTCACAACAAAATCTGCTCAACCTCGAGGTGCGGCCCTACAACGACGACAATCACACTATCTGGGTTGGCGGTGCCGTCAAGTATGTCAGCACACCTACCGAGCAAGACTTTGAGCTCC
CCAGGATATTC
GTGAGTACCAGCTACTGTGCAGTTCCTCACACGGTATTGACGATGATCTGCCGTCACAGTGGAATGGCCTTTCTGAGCAAGATCAGAATAACCTGATCTACAATGTTAT
CTGGCATATGAGCCAGGCTAGTGGTATGGATATCCGCACGAAGCAGTGCAAGATCTTCCAACACGTGAACGAGACTTTGGGTCAGGCCATTGCGAAGGGCGTAGACGCGACTCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGCTGCGAACTGAAGATGGAATTCTCGACTGGCCCTTCCTGAACCACCCTGTGTTCTGGCTTCGTGATCCAGCCAAGTTCCCACATTTCATTCATTCTCAGAAGCGCAACCCCCAAACG
AACTTGCTTGATCACAAT
AATTTCTGGGACTACTTGTCCGCAAACAATGAGTCAATATACCAGGTTATGCGCACAATGTCTGATTTAGGCACGCCATACGGATTCAGGCATATGAATGGT
TTCAGCGGCAACACTTTCCGCGCGGTGAAGGCTGATGGATCGTGGGTCTATATCAA
AACTTCTGCGTACACCGACCAGGGCATTAAGAACAACACCAATGACGAGGCGATCGTACAAGCT
GGTGTGAACCCCGACTTTGGTGTGCAGGACCTCTTCGAAGCCATTGAGGCTGGCAACTACCCCAGCTGGACCATCTATTGGCAGATTATGACTCATCAAGAAGCTGAAAACTTCAAGT
AC
AACGTCTTTGATCTCACGAAAG
AGTGGTTGATTGAAGACGTGCCTCTTCAAGAGATTGGCCGAATCACCCTTGTTCAGAACCCCTTGAATCATTTCTCTGAGGTGGAGCAGATTGGCTTT
GATCCAGCTCAGCTG
CCTAATGGACTTGAGCCGACTGAAGACCCTACGCTCCAAGCACGTTTGTTTGCTTACGCTGATGCCCAGCGCTACCGCACTGGTATTAACCATAAGCAGCTTCCC
ATCAACTGTCCTCTGAATCCCGTTGCCAACTTCTTGCGTGATGGTGCCATGAGCTTCAACAACCAGGGCAAACGCCCCAACTTCTGGTCACAACAAAATCTGCTCAACCTCGAGGTGCGG
CCCTACAACGACGACAATCACACTATCTGGGTTGGCGGTGCCGTCAAGTATGTCAGCACACCTACCGAGCAAGACTTTGAGCTCCCCAGGATATTC
TGGAATGGCCTTTCTGAGCAAGAT
CAGAATAACCTGATCTACAATGTTATCTGGCATATGAGCCAGGCTAGTGGTATGGATATCCGCACGAAGCAGTGCAAGATCTTCCAACACGTGAACGAGACTTTGGGTCAGGCCATTGCG
AAGGGCGTAGACGCGACTCTGTGA

Retrieve as FASTA