Entry information : PinvKat04
Entry ID 10642
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PinvKat04
Name PinvKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvKat04
start..stop
S start..stop
SlutKat03 1266 0 1..745 1..751
SbreKat03 1243 0 1..745 1..752
PplKat03 1134 0 2..745 3..743
PplKat04 1123 0 2..745 3..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 847374..847525 152 N° 2 847580..847844 265 N° 3 847914..848130 217 N° 4 848179..848720 542
N° 5 848788..848936 149 N° 6 848993..849648 656 N° 7 849707..849963 257  
join(847374..847525,847580..847844,847914..848130,848179..848720,848788..848936, 848993..849648,849707..849963)


exon

Literature and cross-references PinvKat04
DNA ref. JGI genome:   scaffold_1 (847374..849963)
Cluster/Prediction ref. JGI gene:   104678
Protein sequence: PinvKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   746
PWM (Da):   %s   83767.24  
PI (pH):   %s   6.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLGEYARKTFTAMTSTAKVADLQRDIQEPLPHEPLTTDHGVKVSDTDNWLKVIGLNGEQNGPMLLEDQIGREKVHRFDHERIPERVVHARGAAAHGYFKVHDNRASRYTYAPVLTDPSRTTSVFVRFSTVQGPRGSADTVRDVRGFAVKFYTEEGNWDIVGNDIPVFFIQDAIKFPDFVHAVKPEPHNEVPTGQSAHNNFWDFVGLQPESAHMIMWVMSDRGIPRSFRMMQGFGVNTYTLLNGKGERHFVKFHFIPELGVHSLVWDEALKISGQDPDFHRKDLNEAIENGAYPRWKFAIQTIPEAHEHDFDFDILDATKVWPEELVPLEEIGELVLNRVVDEFFPETEQVAYCTSHVVPGIGFSDDPLLQGRNFSYFDTQITRLGINFQELPINRPVCPILNHNRDGKGRHRIVKSAVNYWPNRMDTGRPVPPDEGGYVEFAVRLEGIKQRARGKKFQEHFDHAQLFFNSLAPYEKAHLISAISFELSHCEDPVVYRSYVKVLNDIDFDFAKCVAAKVGGEIPSQPGRPNHGKKSKGLSQRDFFPTEPTILSRRIAILIADGFNAAEMHAVRAALTNSKAVCYIIGPRRSHILPMSDQDTNLGIFADHHFEGQRSTLFDALYIPSGAVHANTLAKNGRVVHWVREAFGHCKPIAAVGEAVDFLRDVVRLPKVDLFAPSRGNSDEVVSSYGVVSTGKYSASSAVTDVLKIAPDSKGFVANFAYQVSQHRCYEREMEGLTEIVAF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTCTAGGAGAGTATGCCAGAAAGACATTCACTGCCATGACTTCTACTGCCAAAGTCGCCGATCTGCAGCGTGATATTCAGGAGCCGTTGCCTCACGAGCCCCTCACTACAGAT
CACGGCGTAAAAGTGTCCGATACAGACAATTG
GTGACCAGCACATTATTTGATGCCAACTGCATGTTGTTCACTCGCGTTTGCCAGGCTGAAGGTGATCGGTTTGAACGGTGAACAAAAC
GGACCCATGCTTCTTGAGGATCAGATTGGCCGCGAGAAGGTTCACCGCTTCGACCACGAGCGTATCCCTGAGCGTGTTGTGCATGCCCGTGGTGCTGCAGCCCACGGTTATTTCAAAGTA
CATGACAATCGCGCTTCAAGATACACCTACGCTCCCGTCCTGACGGATCCCTCGAGGACGACTTCTGTTTTCGTCCGCTTCAGCACGGTCCAAGGCCCGAGAGGAAGCGCC
GTCAGTTCT
TTTTGCACTACCCTATCCCCTCGACTCGTTTTCACTGACTGGCCTACCCCCGCCTTTCAGGATACAGTTCGCGACGTTAGAGGCTTTGCAGTCAAGTTCTATACGGAAGAGGGGAATTGG
GACATCGTCGGAAACGACATCCCCGTCTTTTTCATCCAGGATGCTATCAAGTTCCCTGACTTTGTTCACGCCGTGAAGCCAGAGCCCCATAACGAGGTACCGACTGGCCAAAGTGCTCAC
AACAACTTCTGGGATTTCGTGGGTCTCCAGCCCGAGT
GTAGGTCATGTATGCACTTGGTGCGTTGCGGTGCTCATGTTGCTACAGCGGCCCACATGATTATGTGGGTGATGTCTGATCGA
GGCATTCCGCGGTCCTTCCGCATGATGCAAGGCTTTGGTGTCAACACTTACACGCTCCTGAATGGAAAAGGCGAACGTCATTTCGTCAAGTTCCATTTTATCCCAGAACTTGGCGTCCAC
AGTCTCGTCTGGGATGAGGCACTCAAGATATCCGGCCAGGATCCTGATTTTCATCGCAAGGACCTTAACGAGGCCATTGAGAATGGGGCCTATCCGAGATGGAAGTTCGCCATTCAGACC
ATTCCTGAAGCCCACGAACACGACTTCGATTTTGACATTCTGGACGCGACGAAGGTATGGCCTGAGGAACTGGTACCACTCGAGGAGATCGGCGAACTGGTTTTAAATCGTGTTGTCGAC
GAATTCTTCCCTGAAACCGAACAGGTCGCTTATTGCACCAGTCATGTCGTTCCAGGAATTGGTTTCAGCGATGATCCCTTGCTGCAAGGTCGCAACTTCTCTTATTTCGATACTCAGATA
ACACGCCTTGGGATCAATTTCCAGGAG
GTATGCCGTGTCTATGCTGTTGCCGCGCCAATTGACGGTTGATACTTGATACTTGTGATAACCGCAGCTACCCATTAATCGCCCCGTGTGCCC
CATTCTCAATCACAATCGAGATGGCAAAGGTCGGCATCGAATCGTGAAGAGTGCTGTGAACTACTGGCCAAATCGCATGGATACTGGGCGACCTGTTCCTCCAGACGAAGGGGGTTACGT
CGA
GTCAGCTACTTGTTTACTTGTCGTGACGACCCTGCTCAGTGCTGACACTCCCTCAGGTTCGCTGTACGCCTCGAAGGCATCAAGCAGCGGGCGCGCGGGAAGAAGTTTCAAGAGCAC
TTCGATCATGCGCAACTTTTTTTCAACTCGCTCGCGCCTTATGAAAAGGCTCACCTCATTAGCGCCATCTCCTTCGAGCTGAGTCATTGCGAGGATCCCGTTGTCTACCGGTCTTACGTC
AAGGTGCTCAACGACATTGATTTTGACTTTGCCAAGTGCGTGGCCGCCAAAGTAGGCGGTGAGATCCCCAGTCAACCTGGTCGTCCAAACCACGGAAAGAAGAGCAAAGGTTTGTCGCAA
AGGGACTTCTTCCCTACGGAGCCCACTATCTTATCTCGTCGCATTGCTATCCTGATTGCCGATGGCTTTAATGCGGCTGAGATGCATGCTGTTCGCGCTGCGTTGACCAATTCCAAAGCA
GTTTGCTACATCATCGGTCCCAGGCGCAGCCACATTCTTCCCATGTCAGATCAAGACACCAACTTGGGAATCTTTGCCGACCATCATTTCGAGGGACAAAGGTCAACTCTGTTTGATGCA
CTCTATATTCCTTCTGGAGCAGTACACGCCAATACACTAGCGAAGAACGGTCGCGTGGTACATTGGGTTAGGGAGGCCTTCGGGCACTGCAAGCCCATTGCTGCTGTTGGCGAAG
GTTAG
ATGGTCTTTCTTAGCTATTTGATCAAAGTAACTGACATGATTTGTCGTTCTAGCCGTAGACTTCTTACGCGATGTCGTGCGGTTGCCTAAAGTCGATCTCTTCGCTCCGTCTCGAGGTAA
CAGTGACGAAGTGGTCTCGTCTTATGGTGTCGTTTCCACCGGGAAGTATAGTGCCTCCTCAGCAGTTACGGATGTTTTGAAGATCGCTCCCGACTCGAAGGGTTTTGTCGCAAATTTTGC
TTATCAAGTCAGCCAGCATCGGTGTTACGAGCGGGAGATGGAGGGTCTTACTGAGATTGTTGCGTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTCTAGGAGAGTATGCCAGAAAGACATTCACTGCCATGACTTCTACTGCCAAAGTCGCCGATCTGCAGCGTGATATTCAGGAGCCGTTGCCTCACGAGCCCCTCACTACAGAT
CACGGCGTAAAAGTGTCCGATACAGACAATTG
GCTGAAGGTGATCGGTTTGAACGGTGAACAAAACGGACCCATGCTTCTTGAGGATCAGATTGGCCGCGAGAAGGTTCACCGCTTCGAC
CACGAGCGTATCCCTGAGCGTGTTGTGCATGCCCGTGGTGCTGCAGCCCACGGTTATTTCAAAGTACATGACAATCGCGCTTCAAGATACACCTACGCTCCCGTCCTGACGGATCCCTCG
AGGACGACTTCTGTTTTCGTCCGCTTCAGCACGGTCCAAGGCCCGAGAGGAAGCGCC
GATACAGTTCGCGACGTTAGAGGCTTTGCAGTCAAGTTCTATACGGAAGAGGGGAATTGGGAC
ATCGTCGGAAACGACATCCCCGTCTTTTTCATCCAGGATGCTATCAAGTTCCCTGACTTTGTTCACGCCGTGAAGCCAGAGCCCCATAACGAGGTACCGACTGGCCAAAGTGCTCACAAC
AACTTCTGGGATTTCGTGGGTCTCCAGCCCGAGT
CGGCCCACATGATTATGTGGGTGATGTCTGATCGAGGCATTCCGCGGTCCTTCCGCATGATGCAAGGCTTTGGTGTCAACACTTAC
ACGCTCCTGAATGGAAAAGGCGAACGTCATTTCGTCAAGTTCCATTTTATCCCAGAACTTGGCGTCCACAGTCTCGTCTGGGATGAGGCACTCAAGATATCCGGCCAGGATCCTGATTTT
CATCGCAAGGACCTTAACGAGGCCATTGAGAATGGGGCCTATCCGAGATGGAAGTTCGCCATTCAGACCATTCCTGAAGCCCACGAACACGACTTCGATTTTGACATTCTGGACGCGACG
AAGGTATGGCCTGAGGAACTGGTACCACTCGAGGAGATCGGCGAACTGGTTTTAAATCGTGTTGTCGACGAATTCTTCCCTGAAACCGAACAGGTCGCTTATTGCACCAGTCATGTCGTT
CCAGGAATTGGTTTCAGCGATGATCCCTTGCTGCAAGGTCGCAACTTCTCTTATTTCGATACTCAGATAACACGCCTTGGGATCAATTTCCAGGAG
CTACCCATTAATCGCCCCGTGTGC
CCCATTCTCAATCACAATCGAGATGGCAAAGGTCGGCATCGAATCGTGAAGAGTGCTGTGAACTACTGGCCAAATCGCATGGATACTGGGCGACCTGTTCCTCCAGACGAAGGGGGTTAC
GTCGA
GTTCGCTGTACGCCTCGAAGGCATCAAGCAGCGGGCGCGCGGGAAGAAGTTTCAAGAGCACTTCGATCATGCGCAACTTTTTTTCAACTCGCTCGCGCCTTATGAAAAGGCTCAC
CTCATTAGCGCCATCTCCTTCGAGCTGAGTCATTGCGAGGATCCCGTTGTCTACCGGTCTTACGTCAAGGTGCTCAACGACATTGATTTTGACTTTGCCAAGTGCGTGGCCGCCAAAGTA
GGCGGTGAGATCCCCAGTCAACCTGGTCGTCCAAACCACGGAAAGAAGAGCAAAGGTTTGTCGCAAAGGGACTTCTTCCCTACGGAGCCCACTATCTTATCTCGTCGCATTGCTATCCTG
ATTGCCGATGGCTTTAATGCGGCTGAGATGCATGCTGTTCGCGCTGCGTTGACCAATTCCAAAGCAGTTTGCTACATCATCGGTCCCAGGCGCAGCCACATTCTTCCCATGTCAGATCAA
GACACCAACTTGGGAATCTTTGCCGACCATCATTTCGAGGGACAAAGGTCAACTCTGTTTGATGCACTCTATATTCCTTCTGGAGCAGTACACGCCAATACACTAGCGAAGAACGGTCGC
GTGGTACATTGGGTTAGGGAGGCCTTCGGGCACTGCAAGCCCATTGCTGCTGTTGGCGAAG
CCGTAGACTTCTTACGCGATGTCGTGCGGTTGCCTAAAGTCGATCTCTTCGCTCCGTCT
CGAGGTAACAGTGACGAAGTGGTCTCGTCTTATGGTGTCGTTTCCACCGGGAAGTATAGTGCCTCCTCAGCAGTTACGGATGTTTTGAAGATCGCTCCCGACTCGAAGGGTTTTGTCGCA
AATTTTGCTTATCAAGTCAGCCAGCATCGGTGTTACGAGCGGGAGATGGAGGGTCTTACTGAGATTGTTGCGTTCTGA

Retrieve as FASTA