Entry information : GluxAPx-CcP05
Entry ID 10647
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxAPx-CcP05
Name GluxAPx-CcP05
Class Hybrid Ascorbate-Cytochrome C peroxidase    [Orthogroup: APx-CcP003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxAPx-CcP05
start..stop
S start..stop
GluxAPx-CcP[P]09 676 0 1..459 74..515
GluxAPx-CcP07 661 0 1..459 72..511
GluxAPx-CcP08 659 0 1..459 74..514
GluxAPx-CcP06 644 0 1..458 74..512
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 276793..276867 75 N° 2 276919..276991 73 N° 3 277057..277366 310 N° 4 277418..277531 114
N° 5 277601..277778 178 N° 6 277832..278191 360 N° 7 278264..278536 273  
join(276793..276867,276919..276991,277057..277366,277418..277531,277601..277778, 277832..278191,278264..278536)


exon

Literature and cross-references GluxAPx-CcP05
DNA ref. JGI genome:   scaffold_56 (276793..278536)
Cluster/Prediction ref. JGI gene:   47659
Protein sequence: GluxAPx-CcP05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   460
PWM (Da):   %s   49106.94  
PI (pH):   %s   3.86
Sequence 502
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTHDVDDGTGGLDASIQYELDRPQNIGEGMLDSLNDFIAFQIPSPFFSLADTIALGAVFGVAGCGGPVIPFSVGRVDATEAGPATVPEPQQDLASHTESFRRQGFIPTEMIALVACGHTLGGVRQVDFPLIVTDNATVLQTFDTTPSFDTAVVSEYLQNTTQNPLVVGPNVTTRSDLRIFSSDGNATMQSLLSSDTFDQTCGSLFERMLNTVPSNVNLTEPLTEPFDYVITDPAFSYRNGSLSMSTALRVMNNNPSRTVTLLWADRQGSFCPSSGCSTQSTTVQPVFFSIIGQKQGLSAQRYQFNASINAASSISKFWFEVNENDGSQPVVVDNGGAGFVIEQDSVFVDVGRSVQVIGTGLNFLDLVVAVRGDAESSSASITTFTPPQSGNPPPFTPTIDTTTLQLDTINPSEGGFIFFTTNISFDTTFLDVTGTSQSSTVTQKSFDLTAASFPFDFIP*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCCACTCACGACGTAGACGACGGCACTGGGGGACTCGATGCTTCAATTCAGTACGAGCTTGATAGACCACAGGTAAAGCTTTTCAGATTTCTTCCGGAGTCATTTCCCTAATCACCTA
GCCAGAATATTGGAGAAGGAATGCTCGATTCCCTAAACGACTTTATTGCTTTCCAAATACCTTCTCCGTTTTTCAGCTGTACGTGCGAAAAATATTTCCTCTATGACATTTTCTTGTCAG
CTGACTCGAACTCCGATTCACAGTAGCAGATACGATAGCCCTAGGCGCTGTGTTCGGCGTTGCAGGATGCGGGGGGCCTGTGATTCCTTTCAGTGTTGGTCGAGTTGACGCTACCGAGGC
AGGACCGGCGACGGTTCCGGAGCCCCAGCAGGATCTTGCCAGCCACACGGAGTCATTCCGTCGTCAGGGTTTTATCCCCACCGAGATGATAGCCCTCGTTGCGTGTGGGCATACCTTAGG
CGGAGTCAGGCAGGTAGACTTCCCACTGATTGTCACGGACAACGCGACAGTTTTGCAGACTTTTGACACAACGCCTTCTTTCGACACTGCAGT
GTGGGTGATACTTTTGCTTTCTTATAT
AAATTAATAATGGATTGGTCTTAGTGTCTCCGAATACCTCCAAAATACTACCCAGAACCCCCTTGTTGTAGGCCCAAACGTCACCACCAGGTCAGATTTACGGATTTTCTCTAGCGATGG
AAATGCAACAATGCAAAG
GTGTGATACCTTCGGATTTCTGGCTGAAATTAATACATATTTGCTCAATTTTTCTCCTCTGTTTCCCAGTCTGCTCTCCTCCGATACTTTTGATCAAACATG
TGGCAGTCTTTTCGAGAGAATGCTCAACACCGTTCCCAGCAATGTGAACCTCACCGAACCCCTGACAGAGCCATTCGACTATGTCATTACCGATCCAGCATTCTCTTACCGCAACGGCTC
ATTATCTATGAGCACTGCCTTGCGA
GTACGTATCTTTGTGTGTATCGATCCGAGTAAGAGTTTCATGATATATTCTAGGTTATGAACAACAATCCAAGTCGTACAGTGACCTTATTATGG
GCCGATCGCCAAGGATCGTTTTGCCCTTCGAGTGGATGCTCCACACAGTCAACTACCGTTCAACCGGTCTTTTTCAGCATCATCGGCCAGAAACAGGGTCTCTCCGCTCAAAGATACCAG
TTCAACGCATCTATCAACGCGGCATCTTCGATTTCCAAATTCTGGTTCGAGGTGAACGAAAACGACGGTTCTCAACCGGTGGTCGTCGATAATGGAGGGGCAGGGTTTGTTATTGAGCAA
GATTCAGTATTTGTCGATGTTGGCCGTAGCGTGCAAGTTATTGGCACAGGACTCAACTTTTTGGACCTTGTTGTGGCG
GTACGTACTAGAATATCTTTCGATGACTTCATTGGGTGTTAG
CATATACTCACATTTTTCTGCGTAATCTAGGTTCGTGGTGATGCAGAATCCTCCAGCGCGTCCATCACTACATTCACTCCCCCACAGTCGGGTAACCCTCCCCCCTTCACGCCCACGATC
GATACGACCACTCTTCAGCTTGATACGATCAATCCCTCTGAAGGGGGTTTTATATTCTTCACGACGAATATCAGCTTTGATACGACGTTTCTGGATGTCACAGGAACTTCCCAGAGCAGT
ACGGTAACCCAGAAGAGTTTTGACTTGACTGCAGCTAGCTTTCCTTTCGATTTTATACCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCCACTCACGACGTAGACGACGGCACTGGGGGACTCGATGCTTCAATTCAGTACGAGCTTGATAGACCACAGAATATTGGAGAAGGAATGCTCGATTCCCTAAACGACTTTATTGCTT
TCCAAATACCTTCTCCGTTTTTCAGCT
TAGCAGATACGATAGCCCTAGGCGCTGTGTTCGGCGTTGCAGGATGCGGGGGGCCTGTGATTCCTTTCAGTGTTGGTCGAGTTGACGCTACCG
AGGCAGGACCGGCGACGGTTCCGGAGCCCCAGCAGGATCTTGCCAGCCACACGGAGTCATTCCGTCGTCAGGGTTTTATCCCCACCGAGATGATAGCCCTCGTTGCGTGTGGGCATACCT
TAGGCGGAGTCAGGCAGGTAGACTTCCCACTGATTGTCACGGACAACGCGACAGTTTTGCAGACTTTTGACACAACGCCTTCTTTCGACACTGCAGT
TGTCTCCGAATACCTCCAAAATA
CTACCCAGAACCCCCTTGTTGTAGGCCCAAACGTCACCACCAGGTCAGATTTACGGATTTTCTCTAGCGATGGAAATGCAACAATGCAAAG
TCTGCTCTCCTCCGATACTTTTGATCAAA
CATGTGGCAGTCTTTTCGAGAGAATGCTCAACACCGTTCCCAGCAATGTGAACCTCACCGAACCCCTGACAGAGCCATTCGACTATGTCATTACCGATCCAGCATTCTCTTACCGCAACG
GCTCATTATCTATGAGCACTGCCTTGCGA
GTTATGAACAACAATCCAAGTCGTACAGTGACCTTATTATGGGCCGATCGCCAAGGATCGTTTTGCCCTTCGAGTGGATGCTCCACACAGT
CAACTACCGTTCAACCGGTCTTTTTCAGCATCATCGGCCAGAAACAGGGTCTCTCCGCTCAAAGATACCAGTTCAACGCATCTATCAACGCGGCATCTTCGATTTCCAAATTCTGGTTCG
AGGTGAACGAAAACGACGGTTCTCAACCGGTGGTCGTCGATAATGGAGGGGCAGGGTTTGTTATTGAGCAAGATTCAGTATTTGTCGATGTTGGCCGTAGCGTGCAAGTTATTGGCACAG
GACTCAACTTTTTGGACCTTGTTGTGGCG
GTTCGTGGTGATGCAGAATCCTCCAGCGCGTCCATCACTACATTCACTCCCCCACAGTCGGGTAACCCTCCCCCCTTCACGCCCACGATCG
ATACGACCACTCTTCAGCTTGATACGATCAATCCCTCTGAAGGGGGTTTTATATTCTTCACGACGAATATCAGCTTTGATACGACGTTTCTGGATGTCACAGGAACTTCCCAGAGCAGTA
CGGTAACCCAGAAGAGTTTTGACTTGACTGCAGCTAGCTTTCCTTTCGATTTTATACCATGA

Retrieve as FASTA