Entry information : GluxLDS01
Entry ID 10660
Creation 2012-03-02 (Christophe Dunand)
Last sequence changes 2012-03-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxLDS01
Name GluxLDS01
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxLDS01
start..stop
S start..stop
JargLDS01 951 0 24..1071 53..1067
LbiLDS01 925 0 4..1071 36..1070
ScomLDS01 886 0 24..1072 69..1110
PplLDS01-1 836 0 10..1072 40..1006
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 63691..63774 84 N° 2 63830..63886 57 N° 3 63943..64045 103 N° 4 64099..64706 608
N° 5 64758..64964 207 N° 6 65014..65268 255 N° 7 65322..65407 86 N° 8 65460..65628 169
N° 9 65689..65766 78 N° 10 65818..66004 187 N° 11 66058..66440 383 N° 12 66498..66671 174
N° 13 66727..66912 186 N° 14 66972..67239 268 N° 15 67295..67410 116 N° 16 67463..67540 78
N° 17 67591..67761 171 N° 18 67813..67839 27  
join(63691..63774,63830..63886,63943..64045,64099..64706,64758..64964,65014..652 68,65322..65407,65460..65628,65689..65766,65818..66004,66058..66440,66498..66671 ,66727..66912,66972..67239,67295..67410,67463..67540,67591..67761,67813..67839)


exon

Literature and cross-references GluxLDS01
DNA ref. JGI genome:   scaffold_14 (63691..67839)
Cluster/Prediction ref. JGI gene:   40125
Protein sequence: GluxLDS01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1078
PWM (Da):   %s   119521.51  
PI (pH):   %s   6.62
Sequence 1120
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSFQTFISKVGDVVTDLKPVGQTITSLPAILDAVRHPESINDRLLLLEKLLTLMAELGDSKAPPEYQKISLDLQHLAIDLLYKDLPHPPASYLALPPASKPISAKAPTPYKEGQYVTYAYRSADGSNYNPLIPSLGQAGTPYARSSPGFMQTNFKNLPDAGLVFDTLLRRPTKAEAPGEKADGFTPHPGGVNSLFFALADIIIHTLFNTDRQNPTVNNTSSYLDLSVVYGNNEDEVESVRRKDDQNRRDGIGRLYEDVFADNRLLLMPPATCALLVLFSRNHNFVAQRIFEINERGIYKDPATLKAQMNKGFAPGASAEDEKLAKQAKSALNAQDDEIFHRSRLVNCGFYMKVILGDYVGAILGLVKDGKDWRLDPLMEIRRLSHEFSPRGEGNVVSLEFNLLYRWHATLSREDKAWTEKTFKEVLAKAGINTTFDQLTRQQFYRAAGLALSKEQLGDVRTWTFDNLKRDSNGKFSDADIANILQRSTSYRAGAFKARGIPDVLKVIEVLGIEQARGWGACSLNEFRKFIGLEPYKSFKQWNSDESVARAAELLYKDIDNLELHVGMQAEQSKVPGPGAGLCPGYTISRAILSDAVCLTRGDRFLTVDFTPFNFTTWGFEDCQYPSTPDGSFGGMLTKLLFRHFPAYYPARSAYAHFPLLDPKFMKVQMEQAGTADKYIWTRPQTPVGVQTGETVVVDSYAGATEVLYNPKVWKSDYEKKLGIVVSGLQDPKLPDTKLVEEVLRSSSHGWPGFFVETANRLVKERSINHAGSTARYVDIVDDVINALPAHWICDKLIGLNLRDKKAESQFVTGLQDVCDYVFLDWDPVHDWQLRESSVAFFQKLHKVVKHHLESESRFIPNIIGHLLDEKTPFLETLHRDHGNKSANELAAALFCQVVPTAAHWSQSVAHVINYYLDASREGAREEIVKLVDEGKTKQAMDLIKTALVVDPPVYGAERTALRATVVDGLKEAAAGETVFVSIVEANQNIPIGKSGIIGAGEYGLLAAEFFEKVTPGVVGAILGLPKLGRCPGPSGVFTRFTQHTRGAPEQIYINALGGLTPFPTSLIISYDESQSKI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (17 introns). Control slicing prediction!!!
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTTCCTTTCAAACTTTTATCAGCAAAGTAGGTGATGTAGTCACCGACCTCAAGCCCGTTGGTCAAACAATTACGAGCTTGGTGCGCCTAGAATCGACGACCTGTATGGACACTAAAC
TCATCTCAACGTCTGTAGCCCGCGATATTGGATGCAGTAAGGCACCCAGAGAGCATCAATGATCGTCTACTTTTGGCAAGTAACAGCGCAGTCCTTCTGCAGGAGTATTGGCTTACAAGA
TGCGCTATTAGCTTGAAAAGTTGCTCACCCTCATGGCAGAGCTGGGGGACAGCAAGGCACCCCCAGAATACCAGAAGATCAGCTTGGATCTCCAACACTTGGCCATTGACCTTTGTGTGT
ATATCTCTTAGTTTGCTTTCTATAATTCCTGATAGAACGATGTCCAGTGTACAAGGACCTTCCGCACCCTCCGGCCTCATATCTCGCCCTCCCTCCTGCTTCCAAACCAATATCTGCAAA
AGCTCCGACCCCGTATAAAGAGGGGCAGTATGTCACCTACGCGTATCGTTCCGCTGACGGATCCAACTACAATCCCCTGATTCCTTCCTTGGGTCAGGCCGGTACTCCTTACGCGCGTTC
TTCCCCTGGCTTCATGCAAACGAATTTCAAAAACCTTCCCGATGCTGGTCTGGTCTTTGATACCCTCCTGAGACGCCCAACAAAAGCTGAAGCTCCGGGTGAAAAAGCTGATGGATTCAC
TCCTCATCCCGGAGGTGTAAACAGCTTGTTCTTCGCCCTTGCAGACATTATTATTCACACCCTCTTCAACACTGACCGACAAAATCCCACTGTCAACAACACTTCTTCATACCTAGACCT
CAGTGTTGTCTACGGTAATAATGAAGATGAGGTCGAGAGTGTCCGAAGAAAAGACGACCAAAATAGGCGCGATGGTATCGGCAGACTCTATGAAGACGTGTTCGCCGATAACCGTCTCTT
GCTAATGCCTCCGGCAACATGTGCGCTTTTGGTTCTCTTTTCTAGGAATCACAAT
GTAATTGCTTCTCTGTTCTGTTTGCTATCCCATCTAACTGCTCTTTCCTAGTTTGTCGCTCAGCG
CATCTTCGAAATTAATGAGCGTGGAATCTACAAAGACCCCGCTACCTTGAAGGCTCAGATGAACAAAGGGTTTGCTCCTGGAGCTTCTGCGGAGGACGAGAAGCTCGCGAAGCAAGCCAA
GTCTGCTCTCAATGCTCAAGACGATGAGATCTTCCATCGTTCACGTCTTGTCAACTGCGGGTTCTACATGAAG
GTAAGGCGGTGAATCTTGCCTTCTATGATTTTTAACCTGGGATTCAC
AGGTTATTCTCGGGGATTACGTCGGCGCTATTCTTGGGCTCGTAAAAGATGGTAAAGATTGGCGCCTGGATCCTCTCATGGAAATTCGTCGTCTGAGTCATGAGTTTTCTCCTCGAGGAG
AAGGAAACGTTGTATCTCTCGAGTTCAATCTCTTATACCGTTGGCACGCAACTCTAAGCCGGGAAGATAAAGCGTGGACCGAAAAAACATTCAAGGAGGTGCTCGCAAAGGCTGGTATTA
ATACCACATTTGATCAG
GTGAGAATTCAACTTTGTATATCGACGTCCTACTTTGCTAATCCTTTATCTAGCTTACACGTCAGCAATTCTACCGTGCGGCAGGCTTGGCTCTTAGCAAAGA
GCAACTCGGTGACGTTCGAACCTGGACCTTCGATAA
GTTAGTACATTTTTACGATCTCCTTTACTCACCCTAATTTCCTACCCTCTAGCCTCAAGCGTGATAGCAATGGCAAATTCTCTG
ATGCCGACATTGCCAACATCCTGCAACGTTCAACTTCTTATCGAGCTGGAGCCTTCAAGGCCCGAGGAATTCCGGATGTATTGAAAGTTATCGAAGTTCTCGGGATTGAGCAGGCTCGAG
GCTGGGGTGCTTGCTCT
GTAAGGTTTTTTCCCACCATTTCTCCCGTCCTCATTGCTGATAGTTGAATATATTCACAGCTGAATGAATTCAGAAAGTTCATTGGCTTGGAGCCATACAAAT
CATTCAAACAGTGGAATTCCGATGAGTCGGTTGCG
GTGAGGGTTTTGTCTCTGTTAGACTGGAATCGGTCTGATGCAAAACTTTAGAGAGCGGCGGAGCTCCTGTACAAGGACATTGATA
ACCTTGAGCTTCACGTCGGAATGCAGGCCGAGCAATCAAAAGTGCCGGGTCCCGGTGCTGGCTTGTGCCCGGGTTATACCATCTCTCGTGCCATTCTTTCTGATGCTGTATGCCTTACTC
GAGGGGATAGGTTCTTGACTGTAGACTTTACCC
GTGAGCCATTATTTCCGCGGGCCCCTTCTGTTTTGTCTAATTTCGTTCCTTAGCTTTCAATTTTACAACTTGGGGCTTTGAGGACTG
CCAGTACCCGTCGACGCCTGATGGTTCCTTCGGAGGGATGCTTACGAAACTGCTATTCCGTCACTTCCCTGCCTACTATCCAGCCAGGTCCGCCTATGCCCATTTCCCTCTCCTTGATCC
AAAGTTTATGAAGGTGCAAATGGAGCAGGCAGGGACTGCTGATAAGTATATCTGGACCAGGCCCCAAACTCCCGTAGGCGTACAAACGGGAGAGACCGTCGTCGTCGACAGCTATGCTGG
TGCCACAGAGGTCTTGTATAATCCTAAGGTTTGGAAATCAGATTACGAGAAAAAACTTGGTATCGTTGTCAGTGGTTTGCAAGACCCCAAGCTTCCCGACACTAAGCTT
GTAAGTACCTT
GATCGGTGTTGCCGCAGTTTTCGATTCACATTTTCTGTATCAACAGGTCGAAGAAGTCTTGCGCTCTTCCAGCCACGGTTGGCCCGGATTCTTCGTTGAGACCGCCAACCGACTCGTGAA
AGAACGAAGTATCAATCATGCAGGCTCAACTGCAAGATACGTGGATATCGTGGATGATGTCATTAATGCCCTTCCGGCACATTGGATCTGCGATAAACTG
GTAAGACTCAAATGTCTGCT
GCATAAAATTTTCCAGGCTTAGGAGGGCTTTTTAGATTGGGCTTAACCTCAGGGACAAGAAAGCTGAGAGTCAGTTCGTCACCGGCTTGCAAGACGTTTGCGACTACGTCTTTTTGGACT
GGGACCCTGTCCATGACTGGCAGCTACGTGAAAGCTCCGTGGCGTTCTTCCAGAAGTTGCACAAAGTCGTCAAACACCATCTGGAATCCGAGTCCCGCTTT
GTCAGTTGTCTAGTTCCCC
AACTTGTATCTGGATCTGATATTGATACAATCGTTGACAGATTCCCAACATAATCGGTCACCTCTTGGACGAAAAGACACCATTCCTCGAGACTCTTCACAGAGACCACGGTAATAAGAG
TGCAAACGAACTCGCTGCGGCATTGTTTTGCCAGGTCGTCCCTACCGCGGCTCATTGGTCTCAGAGTGTCGCTCATGTTATCAATTATTATCTTGACGCATCCCGGGAAGGAGCCAGAGA
AGAGATTGTTAAGCTTGTCGATGAGGGTAAGACCAAACAGGCAATGGATCTCATTAAGACAGCGCTAG
GTAAGTGGTGCACAGTTTCCTAGGTGAAGCCCCAAAATTCTGAATGTGTATG
AAGTTGTGGACCCTCCGGTTTACGGTGCGGAACGAACTGCTTTGAGGGCTACCGTAGTGGATGGTTTGAAGGAAGCTGCGGCTGGCGAGACCGTCTTTGTGAGCATCGTTGAAGCCAACG
TGAGCCCAAATTTTCCTCGCATTTCGATGATATGAATTAATCATCGCACAGCAAAATATACCTATCGGCAAGTCTGGCATTATTGGGGCTGGTGAATATGGTCTGTTAGCAGCAGAATTC
TTCGAAAAG
GTATGGATACTGTAATAAAATCCTGGATCTTGCTGACGGTTTTATTGCAGGTTACCCCTGGCGTTGTCGGTGCGATTCTTGGTCTGCCCAAACTTGGACGTTGTCCTGGAC
CATCCGGAGTTTTTACGCGTTTCACACAACATACTCGTGGCGCACCGGAGCAAATCTATATCAATGCTCTCGGAGGTCTTACCCCCTTCCCCACTTCTCTTATCATTTCG
GTATGTCCTT
CCTCAAATTTGTAATGCTACGAGGCTCATTCGTTCTTCCAGTACGATGAGTCCCAAAGTAAAATATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCTTCCTTTCAAACTTTTATCAGCAAAGTAGGTGATGTAGTCACCGACCTCAAGCCCGTTGGTCAAACAATTACGAGCTTGCCCGCGATATTGGATGCAGTAAGGCACCCAGAGAGCA
TCAATGATCGTCTACTTTTG
CTTGAAAAGTTGCTCACCCTCATGGCAGAGCTGGGGGACAGCAAGGCACCCCCAGAATACCAGAAGATCAGCTTGGATCTCCAACACTTGGCCATTGACC
TTT
TGTACAAGGACCTTCCGCACCCTCCGGCCTCATATCTCGCCCTCCCTCCTGCTTCCAAACCAATATCTGCAAAAGCTCCGACCCCGTATAAAGAGGGGCAGTATGTCACCTACGCGT
ATCGTTCCGCTGACGGATCCAACTACAATCCCCTGATTCCTTCCTTGGGTCAGGCCGGTACTCCTTACGCGCGTTCTTCCCCTGGCTTCATGCAAACGAATTTCAAAAACCTTCCCGATG
CTGGTCTGGTCTTTGATACCCTCCTGAGACGCCCAACAAAAGCTGAAGCTCCGGGTGAAAAAGCTGATGGATTCACTCCTCATCCCGGAGGTGTAAACAGCTTGTTCTTCGCCCTTGCAG
ACATTATTATTCACACCCTCTTCAACACTGACCGACAAAATCCCACTGTCAACAACACTTCTTCATACCTAGACCTCAGTGTTGTCTACGGTAATAATGAAGATGAGGTCGAGAGTGTCC
GAAGAAAAGACGACCAAAATAGGCGCGATGGTATCGGCAGACTCTATGAAGACGTGTTCGCCGATAACCGTCTCTTGCTAATGCCTCCGGCAACATGTGCGCTTTTGGTTCTCTTTTCTA
GGAATCACAAT
TTTGTCGCTCAGCGCATCTTCGAAATTAATGAGCGTGGAATCTACAAAGACCCCGCTACCTTGAAGGCTCAGATGAACAAAGGGTTTGCTCCTGGAGCTTCTGCGGAGG
ACGAGAAGCTCGCGAAGCAAGCCAAGTCTGCTCTCAATGCTCAAGACGATGAGATCTTCCATCGTTCACGTCTTGTCAACTGCGGGTTCTACATGAAG
GTTATTCTCGGGGATTACGTCG
GCGCTATTCTTGGGCTCGTAAAAGATGGTAAAGATTGGCGCCTGGATCCTCTCATGGAAATTCGTCGTCTGAGTCATGAGTTTTCTCCTCGAGGAGAAGGAAACGTTGTATCTCTCGAGT
TCAATCTCTTATACCGTTGGCACGCAACTCTAAGCCGGGAAGATAAAGCGTGGACCGAAAAAACATTCAAGGAGGTGCTCGCAAAGGCTGGTATTAATACCACATTTGATCAG
CTTACAC
GTCAGCAATTCTACCGTGCGGCAGGCTTGGCTCTTAGCAAAGAGCAACTCGGTGACGTTCGAACCTGGACCTTCGATAA
CCTCAAGCGTGATAGCAATGGCAAATTCTCTGATGCCGACA
TTGCCAACATCCTGCAACGTTCAACTTCTTATCGAGCTGGAGCCTTCAAGGCCCGAGGAATTCCGGATGTATTGAAAGTTATCGAAGTTCTCGGGATTGAGCAGGCTCGAGGCTGGGGTG
CTTGCTCT
CTGAATGAATTCAGAAAGTTCATTGGCTTGGAGCCATACAAATCATTCAAACAGTGGAATTCCGATGAGTCGGTTGCGAGAGCGGCGGAGCTCCTGTACAAGGACATTGATA
ACCTTGAGCTTCACGTCGGAATGCAGGCCGAGCAATCAAAAGTGCCGGGTCCCGGTGCTGGCTTGTGCCCGGGTTATACCATCTCTCGTGCCATTCTTTCTGATGCTGTATGCCTTACTC
GAGGGGATAGGTTCTTGACTGTAGACTTTACCC
CTTTCAATTTTACAACTTGGGGCTTTGAGGACTGCCAGTACCCGTCGACGCCTGATGGTTCCTTCGGAGGGATGCTTACGAAACTGC
TATTCCGTCACTTCCCTGCCTACTATCCAGCCAGGTCCGCCTATGCCCATTTCCCTCTCCTTGATCCAAAGTTTATGAAGGTGCAAATGGAGCAGGCAGGGACTGCTGATAAGTATATCT
GGACCAGGCCCCAAACTCCCGTAGGCGTACAAACGGGAGAGACCGTCGTCGTCGACAGCTATGCTGGTGCCACAGAGGTCTTGTATAATCCTAAGGTTTGGAAATCAGATTACGAGAAAA
AACTTGGTATCGTTGTCAGTGGTTTGCAAGACCCCAAGCTTCCCGACACTAAGCTT
GTCGAAGAAGTCTTGCGCTCTTCCAGCCACGGTTGGCCCGGATTCTTCGTTGAGACCGCCAACC
GACTCGTGAAAGAACGAAGTATCAATCATGCAGGCTCAACTGCAAGATACGTGGATATCGTGGATGATGTCATTAATGCCCTTCCGGCACATTGGATCTGCGATAAACTG
ATTGGGCTTA
ACCTCAGGGACAAGAAAGCTGAGAGTCAGTTCGTCACCGGCTTGCAAGACGTTTGCGACTACGTCTTTTTGGACTGGGACCCTGTCCATGACTGGCAGCTACGTGAAAGCTCCGTGGCGT
TCTTCCAGAAGTTGCACAAAGTCGTCAAACACCATCTGGAATCCGAGTCCCGCTTT
ATTCCCAACATAATCGGTCACCTCTTGGACGAAAAGACACCATTCCTCGAGACTCTTCACAGAG
ACCACGGTAATAAGAGTGCAAACGAACTCGCTGCGGCATTGTTTTGCCAGGTCGTCCCTACCGCGGCTCATTGGTCTCAGAGTGTCGCTCATGTTATCAATTATTATCTTGACGCATCCC
GGGAAGGAGCCAGAGAAGAGATTGTTAAGCTTGTCGATGAGGGTAAGACCAAACAGGCAATGGATCTCATTAAGACAGCGCTAG
TTGTGGACCCTCCGGTTTACGGTGCGGAACGAACTG
CTTTGAGGGCTACCGTAGTGGATGGTTTGAAGGAAGCTGCGGCTGGCGAGACCGTCTTTGTGAGCATCGTTGAAGCCAAC
CAAAATATACCTATCGGCAAGTCTGGCATTATTGGGGCTG
GTGAATATGGTCTGTTAGCAGCAGAATTCTTCGAAAAG
GTTACCCCTGGCGTTGTCGGTGCGATTCTTGGTCTGCCCAAACTTGGACGTTGTCCTGGACCATCCGGAGTTTTTACGCGTT
TCACACAACATACTCGTGGCGCACCGGAGCAAATCTATATCAATGCTCTCGGAGGTCTTACCCCCTTCCCCACTTCTCTTATCATTTCG
TACGATGAGTCCCAAAGTAAAATATAA

Retrieve as FASTA