Entry information : OsPrx58(LOC_Os04g56180)
Entry ID 1068
Creation 2006-07-25 (Filippo Passardi)
Last sequence changes 2006-07-25 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-10 (Christophe Dunand)
Peroxidase information: OsPrx58(LOC_Os04g56180)
Name OsPrx58(LOC_Os04g56180)
Class Class III peroxidase    [Orthogroup: Prx132]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx58
start..stop
S start..stop
SbPrx96 610 0 1..337 1..337
SiPrx94 604 0 9..337 5..333
ZmPrx04 600 0 1..337 1..332
BdiPrx134 590 0 19..337 26..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33539568..33539810 243 N° 2 33539299..33539496 198 N° 3 33537697..33537862 166 N° 4 33534021..33534427 407
complement(join(33534021..33534427,33537697..33537862,33539299..33539496,3353956 8..33539810))


exon

Literature and cross-references OsPrx58(LOC_Os04g56180)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q7XPY0
DNA ref. GenBank:   NC_008397.1 (33539810..33534024)
Protein sequence: OsPrx58(LOC_Os04g56180)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (303)
PWM (Da):   %s   35744.08 (32657.4) Transmb domain:   %s   i12-34o
PI (pH):   %s   9.27 (8.73) Peptide Signal:   %s   cut: 35 range:35-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARAAHGGGGMGLLARAALVAFVALVGVGGGARAQLRQNYYGSTCPNAESTVRSVISQHLQQSFAVGPGTLRLFFHDCFVRGCDASVMLMAPNGDDESHSGADATLSPDAVEAINKAKAAVEALPGCAGKVSCADILAMAARDVVSLTGGPSYSVELGRLDGKTFNRAIVKHVLPGPGFNLDQLNSLFASNGLTQTDMIALSGAHTIGVTHCDKFVRRIYTFKQRLGYNPPMNLDFLRSMRRVCPINYSPTAFAMLDVSTPRAFDNAYFNNLRYNKGLLASDQILFTDRRSRPTVNLFAANSTAFFDAFVAAMAKLGRIGVKTGSDGEIRRVCTAVN

Retrieve as FASTA  
Remarks chromosome 4. No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGGGCGGCGCACGGCGGCGGCGGCATGGGGCTTCTCGCGCGGGCGGCGCTCGTGGCATTCGTGGCGCTTGTGGGCGTCGGCGGCGGCGCGAGGGCCCAGCTGCGGCAGAACTAC
TACGGCAGCACGTGCCCCAACGCGGAGTCCACCGTCCGGTCCGTCATCTCGCAGCACCTCCAGCAGAGCTTCGCCGTCGGCCCCGGCACCCTCCGCCTCTTCTTCCACGACTGCTTCGTC
AGG
GTACGTCCTCTCTCTCGGTCTCGGTCTCTCGGCGTTTTGGGTGTTCATCTTCTCGGCGTTTGCGTTTGCAGGGGTGTGACGCGTCGGTGATGCTGATGGCGCCGAACGGCGACGACG
AGAGCCACAGCGGCGCGGACGCCACGCTGTCGCCGGACGCGGTGGAGGCGATCAACAAGGCCAAGGCGGCGGTCGAGGCGCTCCCCGGCTGCGCCGGCAAGGTCTCCTGCGCGGACATCC
TCGCCATGGCCGCCCGCGACGTCGTCTCCCTG
GTAACAATAAACACTACTGTACACACAAATCCCCGTCCTGTCGCGACTCGTCACGTCCTAGTGTGCGTTCAACAATACTAGTACTACA
ATGCGGTGTACCGCCGGCTCGACTGTAGTGTAGGGCACGCCCTTGTCAGTCGCCAGCAAGCACGGACCCACCCTGATTGGCAAGCTCAAGCATCGGCGTAGTAGTACTAGCGTTCATACT
CCCCATCATCCTGTGTGTGGAGTACTCCTAGTACGTTGCAATTGCAAGTGCTAACGCTTTTAAGCAGAGAGGGCAGCCGGGGGCCCACCACGCCGGTGCGATGACAGGTGGGGCCGACGG
AGCTACTGTTGCATCCAGCGCGCCAGTAACCCCTTTTTTTTGACAAACTGGACCATCGATCGATCGATCTATCCAGCCGTGAGCCCATGGCCATGAGTCATGGCTGACTCCGGCCATGAG
ACACCGCAGACACGAGCCACGCATGGTCCATGTCTCCCCGGTTGGTTCCGGTGCTCCACGTCTCCACAGCCTGACCCGCACAGTGGCTGCAGGCAGTAGCCGCAGGCGCTGTGCTGGGTT
CGGTTTAGTTCGGTCGCTCTGGCTGGCTGGCCTTTCGCAGTTTGGCCCCCTCCTACGAAAAAAAGAAAGAAAAGGGGAAAGTCGCTTACGGAGACATGTGAGCCGTGTCGGCCTCGGCTT
CCGCGCGAGGAAACCGCCGCGCGGCGCTTGCGATTGCGCATGCGCACGGTCGTGGTTTGCTGGCTCGCGCACTGTGGCGCATTCGCCGGGTTTGATAGGCGATATCGCGTAGTGGCGGGG
CGCGGGGCGCCCGAGCATACGAGCGTACGAGGCGGGTATTCTCCTCCTGTGTCTCCGGCTATCCGCTATCTTTTGAGATGGCAACAGCTTTGAGCGTACTGCGGCTACTGCCTGCACAGT
ATTGCTTTGAGCGTACGATGACTCTATTGAACGAGTATTGCTTTTTCTGCGGCATGGATTTCTGCGAAAGCGACGTCTCGTAGCCCGTAGGAGTGGTTTCTAAATTGTAACCTCGGTCCA
ACTGGGTAAATACTTCTCCTGAACTGTAGTACGCTGCTCCTGTCCGTGTTGCCCGTGACGCTTGCCGTATTACCCTTGCCTAAAAACAGTCCCGTGGCTGGGCTCGTGGGCGCTGCCAGA
GCAAGGCTGGAAATTTTCCTCGTTCTCAGCAAGCAGGCAGACAAAATTTCCACCGGGTAGACATCTAGACATGACGTTGTATTAACAGTTCTCTCGGAGAGCCAAGAAAAGGTTGCTGAA
TAATCACAAGCCATGCATATCTACCTGCATTCTGAAACTGCTAATAATGAAGTAACGATTGCCGTTGAAGCAGAGATGTTAGTGCGTTGCATTCGCTAATTTGTTCACTTACTGACATTG
CATGATATGTTGCTTTGTGTTGTTGTAGACCGGCGGGCCGAGCTACTCCGTGGAGCTCGGACGGCTGGACGGCAAGACGTTCAACAGAGCCATTGTCAAGCACGTCCTGCCCGGCCCTGG
CTTCAATCTGGATCAGCTCAACTCCTTGTTCGCCAGCAATGGCCTAACGCAGACCGACATGATTGCGCTTTCCG
GTAAGCTTCTTCCTTCCTGCCTCAAAATTTCCATTGACGTGGAGAA
ATTTTACATGGTTGATACTAGCCGTTCTGAAAAAGCATCAGGTTACTGTTTTGTGAACGTTGAGGCGACAATAGCATGGTTGCCGGTTACCCACAGAAATTAACAATTCCTCGTTAGGGT
TGCATTTTTTTTATTACAAGTATTAGTAGCAGGTTGATCGCAGTGCAAGCATCTTTTTTTCGTGGCCTCTGCACTTCACGTGAGTGACATATCCTCTGTTTGCAACAGAAGACAAAGCAG
TTCGCTGTTTTATACTGGTTTCATCTGTTCTTTTCGAAAACGAAAAGAGGCTCGTTTGTTTTTGTTTGATTATAATGCAAAGTAGACAAAAAAACACAAGCGTGGAGTAGTAGTACTTGC
TTTGCAGGGAATTTCACATTTAGATGTAAAAAAGACCGGCAGAAAGCGATGAAATATTCTTTGTAGCTACTATAAAACCGAAGCTGTTTTTAAAACACACGCATGTTTCTTTCAGAAAAA
AGAACAAAGTGTACTACGGAGTATTTCCTCCATTCTAAATTATAAGCATTTTCATAATAGTGCTAAGTTAAACATTTTCTATTTTGACCATTAATAGCAAAAATAAAATAAAATGATAAA
TCATATAAAATTGATGTTATTAGATTTATCATTAAACAAACTATCGTAATATGTAAGTCTTTTTATTTAGATCATCTTACTTTTATAGATATTATTAGTTAAAGTAGCATATCAAAGACT
ATGTCAAGATTCAAAAATACTTATATTTTAGGATAGATTGAAGTAGTACATTGTAGAGGATTTTTAAAAGATTTTTCTGTTCCTTTTGTGCGTTCCAATGGGTGAAAAAATTCTAATGAT
AATATAAGTTTTTCATTAATAATCATGTCAATGACAATGTTTGTATTTTAATGAGCGGTTTGTTCTTTTATAAACGGTGTTTTTTTCTTGCGCGATTTTCTCAAACCATTCAGAAATGAC
GCACTTCTTTCTAAAAGTTTTTTTAGCATTTTTTTGCTTTTTATTTACAACAAAAACCATATTTTTCTCCCTTTTGTTCATTTTCTTTTCTCGTGTGTTTTTTGCACTTTTTTTTGACAA
TTATTTTCTCGCGCGTTTTTTGCTTGTTTTTTCTTCAAATGTTCTTTTTTTTGCTTTTTTCCAATACATGAGAATATATTACGGAATAAAAGCCATGTAGTAGGTGGCAAAAAAAAATCG
ATGGATCCTATCCGACTCAAGCGTCCATCGATTTAACGTTTTTTCTGATAATTTTCTTAGAGTGATTTTTTTAATAGACGCTGTTTTTTTTCTTGCGCGGTTTTCTAAAACCATTTTTTA
GAAATGTCGCGTTTTTCTGACAGTTTTTTCCTCGCATGTTTTTTTTAAAAAATTACCAATGATGGAAATAATTTTTCTCGCGTGTTTTTTTATTTTTTATGGAAGATGGAAAACCTTTTT
AGCGTATTTTTTTGCGCTTTTTTCTTACTTTTTTCTCACGCGTGTTTTTGAACCGTTTTTATTTTCTCGTGCATTTTCTCTTTTTAAATAGTTAGATTATATTAGAGATAGAGAAGAGAT
ATATATTGATTAGAAATCGGACTTTGTTTCGTCATTTCCATTTTATTTCTAGTGTGCATTTTTTTATTTTATACGAACCAACTTTTTATTTTTTATGAACTATTTTTTTTGCCACTTTCT
TAGGGGATCGAACGAACGGACTTGTCAGATGTTTTTTCGGTTTTTTCGCCTTTATAGGAATCAAACTTTTTTTCCCTTTTTAAAGAAATCGAATCTAGTGTTTTTTCACCACTTTTTTTT
TTTGCCTTTTATAGGAATCAGATTTTTTTTTCGTTCGGATCTATGGTTTTTTTCGCCACTTATGGGAAACAGAACTTTTGTTGTTTTTCTTTTTATGCAACTTTCTGCTTTTGTTATCTC
TCTTTTATTATTATTTTTAACAAAAACGACCTCAAATACCTTATTGTAAGATTATAGGGACTCAAATGTAAATATAAAAATTATAGGGACTCAAATGCAAAAGTACAAACCAAAAATTAA
AATAATATAAAAATGGAATGCTCTCGACCTGTAGATTCCGTTTTTGTAAACAGATCTTCAATCCGTCACATCATTTTGTTTCACCAAGATGTGAGAGATATCACGGTATAAATTGAAACC
GAGAGGAGTGGTGGCTGGTATCTCGGACTTAAAAGGAGTGGTGACTTTTATTTTTCAGGGGGATCGGATCTATAGTCGGACTTTTTTTTTCGTTTCTGAGAGGGAATCAGATAGGAGTTG
GATTTTTTTTAATTTTTCGCTAATTTTTTTTGTTTTGACGCACGAAGGAAACATATCTTTTTTTTAAGTTGTAGAGATAGAGATTTTTTTTCGCCCTTTTTTTTGGCACGGAATCGGATT
ATTTTTTTCGTTTTTTTGTCGCTCTTCTTTTTCACGGAGAATTTTTTCAGCCTTTTTTTTTTTGCATGGAATCGGATTATTTTTTCGCCCCCTTTTTTTATCGGACAACTACGGTTTTTT
TCTCACTCGTCTGGTTTTTTTCCGGTTTTTTTGTCGCAGATTGTTTCTTTTCGCCTTTTTTTATCGGATAGTTACGGTTTTTTCGTCCGGTTTTTTCTCACTCGTTCGGTTTTTTTGGGC
GGTTTTTTGACAGACAATGGAAGCACCTCTTATTTTTTTTTAAGTAGTAGTAGGCATATTTGATTAATCTTAAATACCCTTGCTGGGTTGGGGCAAGGGAAGAATAAAAAAGATCTTAGT
ACTACATGAGAACTGGGGCGATTTTGTCTGAATGTTTTTGGTCCTGTCAGATCCTAAGCTTAGTTTAAACAATCTTTGTGTCTAGATTTGGACACAAGAGGCCCTACCCTTGTGACAAAA
CCGAAACCACCACAACCACTAGCGGTAACTTTTGACCGAACCAGAGCCACTCCTGACTCTGCATATAGTAGTACAGTAAAAAGGTTAAAACAACTGTACAGGCACAGACCGGAACAAACA
ATACTTCCTCTACTTACTCTGTTTCACGATATAAAACTTTCTAGCATTACTCATATTTATTTAGATATTAATGAATCTAAATATATATATATATATATGTTTAGATTTATTAATATCTAT
ATGTATGTGGTTAATGCTAGAAAGTCTTATATTGTGTAACGGAGGGAGTAGTTTTTTTTCTCACTGAAATGATTCTGATATTGACGGTGCACACGCACTGCAGGGGCGCACACGATCGGG
GTGACGCACTGCGACAAGTTCGTGCGGCGGATCTACACGTTCAAGCAGCGGCTGGGGTACAACCCGCCGATGAACCTGGACTTCCTGCGGTCGATGCGGCGGGTGTGCCCGATCAACTAC
AGCCCGACGGCGTTCGCGATGCTGGACGTGTCGACGCCGCGGGCGTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTCCTCGCCTCCGACCAGATCCTCTTCACCGAC
CGCCGCTCCCGCCCCACCGTCAACCTCTTCGCCGCCAACTCCACCGCCTTCTTCGACGCCTTCGTCGCCGCCATGGCCAAGCTCGGCAGGATCGGCGTCAAGACCGGCTCCGACGGCGAG
ATCCGCCGCGTCTGCACCGCCGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGGGCGGCGCACGGCGGCGGCGGCATGGGGCTTCTCGCGCGGGCGGCGCTCGTGGCATTCGTGGCGCTTGTGGGCGTCGGCGGCGGCGCGAGGGCCCAGCTGCGGCAGAACTAC
TACGGCAGCACGTGCCCCAACGCGGAGTCCACCGTCCGGTCCGTCATCTCGCAGCACCTCCAGCAGAGCTTCGCCGTCGGCCCCGGCACCCTCCGCCTCTTCTTCCACGACTGCTTCGTC
AGG
GGGTGTGACGCGTCGGTGATGCTGATGGCGCCGAACGGCGACGACGAGAGCCACAGCGGCGCGGACGCCACGCTGTCGCCGGACGCGGTGGAGGCGATCAACAAGGCCAAGGCGGCG
GTCGAGGCGCTCCCCGGCTGCGCCGGCAAGGTCTCCTGCGCGGACATCCTCGCCATGGCCGCCCGCGACGTCGTCTCCCTG
ACCGGCGGGCCGAGCTACTCCGTGGAGCTCGGACGGCTG
GACGGCAAGACGTTCAACAGAGCCATTGTCAAGCACGTCCTGCCCGGCCCTGGCTTCAATCTGGATCAGCTCAACTCCTTGTTCGCCAGCAATGGCCTAACGCAGACCGACATGATTGCG
CTTTCCG
GGGCGCACACGATCGGGGTGACGCACTGCGACAAGTTCGTGCGGCGGATCTACACGTTCAAGCAGCGGCTGGGGTACAACCCGCCGATGAACCTGGACTTCCTGCGGTCGATG
CGGCGGGTGTGCCCGATCAACTACAGCCCGACGGCGTTCGCGATGCTGGACGTGTCGACGCCGCGGGCGTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTCCTCGCC
TCCGACCAGATCCTCTTCACCGACCGCCGCTCCCGCCCCACCGTCAACCTCTTCGCCGCCAACTCCACCGCCTTCTTCGACGCCTTCGTCGCCGCCATGGCCAAGCTCGGCAGGATCGGC
GTCAAGACCGGCTCCGACGGCGAGATCCGCCGCGTCTGCACCGCCGTCAACTAG

Retrieve as FASTA