Entry information : PcarMnP06
Entry ID 10680
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PcarMnP06
Name PcarMnP06
Class Manganese peroxidase    [Orthogroup: MnP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarMnP06
start..stop
S start..stop
PcarMnP07 649 0 1..383 1..383
PcarMnP03 639 0 29..383 28..382
PcarMnP01 637 0 1..383 1..383
PcarMnP05 625 0 1..380 1..380
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3167439..3167573 135 N° 2 3167631..3167682 52 N° 3 3167735..3167761 27 N° 4 3167816..3167855 40
N° 5 3167913..3168090 178 N° 6 3168152..3168373 222 N° 7 3168424..3168838 415 N° 8 3168901..3168992 92
join(3167439..3167573,3167631..3167682,3167735..3167761,3167816..3167855,3167913 ..3168090,3168152..3168373,3168424..3168838,3168901..3168992)


exon

Literature and cross-references PcarMnP06
DNA ref. JGI genome:   scaffold_5 (3167439..3168992)
Cluster/Prediction ref. JGI gene:   256980
Protein sequence: PcarMnP06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   387 (366)
PWM (Da):   %s   40325.71 (38177.5)  
PI (pH):   %s   4.07 (3.99) Peptide Signal:   %s   cut: 21 range:21-386
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKFSSLLALVATAATVRAAPASTAATCSDGTQVPNEVCCNFVPLISALQNNLFMEDCGEDAHEVIRLTFHDAIAISRSQGPTAGGGADGSMLIFPTVEPSFSANNGIGDSVDNLIPFLSQFPAVSAGDLVQFAGTVALSNCPGAPQLEFLAGRPNATAPAVDGLIPEPQDNVTHILERFADAGGFSPFEVVSLLASHSIARADKVDETIDAAPFDSTPFVFDTQVFLEVLLKGVGFPGTDNNTGEVASPLPTTVGTDTGEMRLQSDFALARDERTACFWQSFVNQEDFMASSFKAAMSKLAILGHNREDLVDCSAVVPVPKPAVNKPASFPAGTSPEDLQLTCTTEKFPTLTIDAGAQQTLIPHCSDGNMTCNTVQFNGPAAGV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGTTCTCCTCCCTCCTCGCCCTCGTCGCCACTGCCGCGACCGTGCGCGCTGCCCCGGCCTCCACCGCCGCCACCTGCTCCGATGGTACACAGGTCCCCAACGAAGTTTGC
TGCAACTTCGTCCCC
GTATGCCTACTTCACATCACACTATGCTACAGCGGTGACTAAATCACTTAAATACAGCTTATCTCGGCGCTCCAGAACAATCTGTTCATGGAAGACTGCGGTGAA
GACG
GTAGGTCCTGTCTTCCCTGATCTGTGGCAATAGCACTAACATCTCGTCTAAGCCCACGAGGTCATCCGTCTTACTTTCCGTGAGTAACACTCCATTGAAAATAGTCGTCAACATAC
TCACCATGCCTTACCAGACGATGCCATTGCTATCTCTCGGAGCCAGGGTCCCACAGCGTGAGTGCCGCCATCTATTGATCAGTGATCATAAACATACTTACCTCAAATGTTCAGTGGTGG
TGGAGCCGACGGGTCGATGCTCATCTTCCCGACCGTCGAACCGTCGTTCTCAGCGAACAACGGCATCGGCGACAGTGTCGACAATCTGATTCCGTTCCTCTCCCAGTTCCCCGCCGTCTC
CGCTGGCGATCTCGTCCAGTTCGCAGGCACGGTCGCGCTCAGCAACTGCCCT
GTAAGTGATCGTGGCACACAGATACTGATATGCTATATTCTGACATAACTCCTTTCAATAGGGCGCGC
CCCAACTTGAGTTCCTTGCCGGTCGCCCGAACGCGACTGCCCCCGCCGTCGACGGCCTGATCCCCGAGCCCCAGGACAACGTCACCCACATTCTCGAGAGGTTCGCCGATGCTGGTGGCT
TCAGTCCCTTCGAGGTCGTCTCCCTGCTCGCTTCCCACTCCATCGCTCGCGCGGACAAGGTCGACGAGACAATCGATGCTGCGCCCTTCGACTCC
GTAAGCGACAATGTTTCTTATCATA
ATCACCCGCTAACCGATATTTGCAGACCCCGTTCGTGTTCGACACCCAGGTCTTCCTCGAGGTCCTGCTTAAGGGCGTTGGCTTCCCCGGAACCGACAACAACACCGGCGAGGTTGCATC
TCCTCTCCCAACGACCGTCGGCACCGACACCGGCGAGATGCGTCTCCAGTCTGACTTCGCCCTCGCCCGCGACGAGCGCACTGCTTGCTTCTGGCAGAGCTTCGTCAACCAGGAGGATTT
CATGGCGTCGAGCTTCAAGGCGGCCATGTCCAAGCTCGCCATCCTCGGCCACAACCGCGAGGACCTCGTCGATTGCTCCGCCGTCGTCCCCGTGCCGAAGCCCGCGGTCAACAAGCCCGC
GAGCTTCCCCGCCGGCACTAGCCCTGAGGACCTCCAGCTCACGTGCACGACTGAGAAGTTCCCGACTCTGACCATTGATG
GTGCGTGTCTGCGGACGTCTCGATTTTGATTGCAATTGGA
CTGACTTTCGACTCTCGTACAGCCGGTGCCCAGCAAACTCTGATCCCGCACTGCTCTGACGGCAACATGACGTGCAACACCGTCCAGTTCAACGGCCCGGCTGCTGGTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGTTCTCCTCCCTCCTCGCCCTCGTCGCCACTGCCGCGACCGTGCGCGCTGCCCCGGCCTCCACCGCCGCCACCTGCTCCGATGGTACACAGGTCCCCAACGAAGTTTGC
TGCAACTTCGTCCCC
CTTATCTCGGCGCTCCAGAACAATCTGTTCATGGAAGACTGCGGTGAAGACGCCCACGAGGTCATCCGTCTTACTTTCCACGATGCCATTGCTATCTCTCGGAGC
CAGGGTCCCACAGC
TGGTGGTGGAGCCGACGGGTCGATGCTCATCTTCCCGACCGTCGAACCGTCGTTCTCAGCGAACAACGGCATCGGCGACAGTGTCGACAATCTGATTCCGTTCCTC
TCCCAGTTCCCCGCCGTCTCCGCTGGCGATCTCGTCCAGTTCGCAGGCACGGTCGCGCTCAGCAACTGCCCT
GGCGCGCCCCAACTTGAGTTCCTTGCCGGTCGCCCGAACGCGACTGCC
CCCGCCGTCGACGGCCTGATCCCCGAGCCCCAGGACAACGTCACCCACATTCTCGAGAGGTTCGCCGATGCTGGTGGCTTCAGTCCCTTCGAGGTCGTCTCCCTGCTCGCTTCCCACTCC
ATCGCTCGCGCGGACAAGGTCGACGAGACAATCGATGCTGCGCCCTTCGACTCC
ACCCCGTTCGTGTTCGACACCCAGGTCTTCCTCGAGGTCCTGCTTAAGGGCGTTGGCTTCCCCGGA
ACCGACAACAACACCGGCGAGGTTGCATCTCCTCTCCCAACGACCGTCGGCACCGACACCGGCGAGATGCGTCTCCAGTCTGACTTCGCCCTCGCCCGCGACGAGCGCACTGCTTGCTTC
TGGCAGAGCTTCGTCAACCAGGAGGATTTCATGGCGTCGAGCTTCAAGGCGGCCATGTCCAAGCTCGCCATCCTCGGCCACAACCGCGAGGACCTCGTCGATTGCTCCGCCGTCGTCCCC
GTGCCGAAGCCCGCGGTCAACAAGCCCGCGAGCTTCCCCGCCGGCACTAGCCCTGAGGACCTCCAGCTCACGTGCACGACTGAGAAGTTCCCGACTCTGACCATTGATG
CCGGTGCCCAG
CAAACTCTGATCCCGCACTGCTCTGACGGCAACATGACGTGCAACACCGTCCAGTTCAACGGCCCGGCTGCTGGTGTGTAA

Retrieve as FASTA