Entry information : WsebCcP
Entry ID 10683
Creation 2012-03-05 (Christophe Dunand)
Last sequence changes 2012-03-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-20 (Catherine Mathe (Scipio))
Peroxidase information: WsebCcP
Name WsebCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Wallemiomycetes Wallemia
Organism Wallemia sebi    [TaxId: 148960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value WsebCcP
start..stop
S start..stop
ScomCcP 362 1e-124 9..369 16..376
Cpmi390CcP01 359 3e-123 91..367 100..373
HrufCcP01 358 4e-123 19..370 22..371
CnCcP01_JEC21 357 1e-122 10..358 15..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 233385..233745 361 N° 2 233791..233813 23 N° 3 233863..233965 103 N° 4 234012..234115 104
N° 5 234158..234679 522  
join(233385..233745,233791..233813,233863..233965,234012..234115,234158..234679)


exon

Literature and cross-references WsebCcP
DNA ref. JGI genome:   scaffold_5 (233385..234679)
Cluster/Prediction ref. JGI gene:   31834
Protein sequence: WsebCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   370
PWM (Da):   %s   41953.06  
PI (pH):   %s   6.53
Sequence 412
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLKNINRLNKNISRDLYNRSSLIRRQGIKSYSSHSTHSTPNESTVNSKLIFTTGAILTGFGLVYFNNYQGSANQAIAKVEEKLPVDSASRDYQKVYNAIVDVLETEDYDDGSFAPVLLRLAWHASGTYSKYDKANPGGSNKATMRFKAEAKDEANAGLEIGRDLLNNKVKPQFPWISYGDLWTLAGVVGLQEMGGPKVAWRPGRIDGTDEREAITNRLPDGAKDEHHIQNIFNRLGFNDREAVCLIGAHAVGRTHKDRSGFEGPWTFSPISFSNQFYKLLLESDWKEKQWDGPKQYEDQETKSLMMLPTDYALRTSERYRPYVEKYAENEDLFFEDFAKAFAKLIELGVPLKQFEHSPPVFFKTSDEVDS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCTGAAAAACATAAACAGATTAAATAAGAATATTTCCAGAGATTTATATAATAGGTCATCTCTTATTCGTCGACAAGGAATTAAGTCATATTCGTCACATTCGACACATTCTACACCAA
ATGAATCAACTGTTAATAGTAAACTTATATTCACAACTGGTGCTATATTAACAGGATTTGGATTGGTTTATTTCAATAACTACCAAGGTTCTGCTAATCAAGCTATCGCGAAAGTTGAAG
AGAAGTTACCAGTTGATTCAGCTTCACGTGACTATCAGAAAGTTTATAATGCTATTGTAGATGTATTGGAAACAGAGGACTATGATGATGGCTCATTTGCTCCTGTTCTCCTCAGATTAG
GTGCGTGATTTACTACTATCAACAGAATCAATTGACATAATGTAGCTTGGCATGCAAGCGGTACTTACGTTAGTACTATACTTACACTTAGACTGACAATCGCTTATTATAATGCAGAGC
AAGTATGACAAAGCCAACCCAGGTGGATCAAACAAAGCTACGATGCGTTTCAAGGCTGAAGCAAAAGATGAGGCAAATGCAGGTTTAGAAATCGGTAGAG
GTTAGTTACCAAAATGACCG
TTTGATAACTATCTAACTATATTTAGATCTTCTGAACAACAAAGTAAAACCACAGTTCCCATGGATTTCATATGGCGATTTATGGACCTTAGCCGGTGTTGTTGGATTGCAAGAAATGGG
TGGTCCAAAG
GCAAGTATCGTTTAAATTATAAATTTCACTAACAACTTTTAGGTTGCTTGGCGCCCTGGCCGTATAGATGGTACAGATGAACGTGAAGCAATTACGAATAGGCTTCCAGA
TGGTGCTAAAGATGAGCATCATATTCAAAACATATTCAATAGATTAGGATTTAATGACAGAGAAGCAGTTTGCTTGATTGGTGCTCATGCAGTTGGTAGAACCCATAAAGATCGTAGCGG
ATTTGAAGGTCCTTGGACATTCAGTCCAATCTCCTTCTCTAATCAATTTTACAAACTGTTACTTGAATCCGATTGGAAAGAAAAACAATGGGATGGACCAAAACAGTACGAAGATCAAGA
GACAAAATCTTTAATGATGCTTCCAACAGATTACGCGCTTAGAACAAGTGAGCGTTACAGACCATACGTTGAAAAATATGCGGAAAATGAGGACTTATTCTTTGAAGATTTCGCCAAAGC
TTTTGCAAAATTAATTGAATTGGGAGTACCCCTCAAACAATTTGAGCATTCACCGCCAGTATTTTTTAAAACCTCAGATGAAGTTGATTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCTGAAAAACATAAACAGATTAAATAAGAATATTTCCAGAGATTTATATAATAGGTCATCTCTTATTCGTCGACAAGGAATTAAGTCATATTCGTCACATTCGACACATTCTACACCAA
ATGAATCAACTGTTAATAGTAAACTTATATTCACAACTGGTGCTATATTAACAGGATTTGGATTGGTTTATTTCAATAACTACCAAGGTTCTGCTAATCAAGCTATCGCGAAAGTTGAAG
AGAAGTTACCAGTTGATTCAGCTTCACGTGACTATCAGAAAGTTTATAATGCTATTGTAGATGTATTGGAAACAGAGGACTATGATGATGGCTCATTTGCTCCTGTTCTCCTCAGATTAG
CTTGGCATGCAAGCGGTACTTACAGCAAGTATGACAAAGCCAACCCAGGTGGATCAAACAAAGCTACGATGCGTTTCAAGGCTGAAGCAAAAGATGAGGCAAATGCAGGTTTAGAAATCG
GTAGAG
ATCTTCTGAACAACAAAGTAAAACCACAGTTCCCATGGATTTCATATGGCGATTTATGGACCTTAGCCGGTGTTGTTGGATTGCAAGAAATGGGTGGTCCAAAGGTTGCTTGGC
GCCCTGGCCGTATAGATGGTACAGATGAACGTGAAGCAATTACGAATAGGCTTCCAGATGGTGCTAAAGATGAGCATCATATTCAAAACATATTCAATAGATTAGGATTTAATGACAGAG
AAGCAGTTTGCTTGATTGGTGCTCATGCAGTTGGTAGAACCCATAAAGATCGTAGCGGATTTGAAGGTCCTTGGACATTCAGTCCAATCTCCTTCTCTAATCAATTTTACAAACTGTTAC
TTGAATCCGATTGGAAAGAAAAACAATGGGATGGACCAAAACAGTACGAAGATCAAGAGACAAAATCTTTAATGATGCTTCCAACAGATTACGCGCTTAGAACAAGTGAGCGTTACAGAC
CATACGTTGAAAAATATGCGGAAAATGAGGACTTATTCTTTGAAGATTTCGCCAAAGCTTTTGCAAAATTAATTGAATTGGGAGTACCCCTCAAACAATTTGAGCATTCACCGCCAGTAT
TTTTTAAAACCTCAGATGAAGTTGATTCATAA

Retrieve as FASTA