Entry information : ScomCcP
Entry ID 10708
Creation 2012-03-06 (Christophe Dunand)
Last sequence changes 2012-03-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: ScomCcP
Name ScomCcP
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Schizophyllaceae Schizophyllum
Organism Schizophyllum commune    [TaxId: 5334 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ScomCcP
start..stop
S start..stop
AthiCcP01 569 0 4..375 2..369
PoCcP_PC9 568 0 12..376 6..372
MfiaCcP01 565 0 1..376 1..378
AmusCcP01 565 0 4..377 2..377
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 878466..878774 309 N° 2 878366..878414 49 N° 3 878073..878308 236 N° 4 877905..878021 117
N° 5 877839..877855 17 N° 6 877721..877786 66 N° 7 877515..877664 150 N° 8 877374..877457 84
N° 9 877218..877323 106  
complement(join(877218..877323,877374..877457,877515..877664,877721..877786,8778 39..877855,877905..878021,878073..878308,878366..878414,878466..878774))


exon

Literature and cross-references ScomCcP
DNA ref. JGI genome:   scaffold_8 (878774..877218)
Cluster/Prediction ref. JGI gene:   85712
Protein sequence: ScomCcP
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   378
PWM (Da):   %s   42276.07 Transmb domain:   %s   i50-72o
PI (pH):   %s   8.73
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQAFARLRQPLRAASRQIARPSTRNATPTFRASFRRFNSTEAPKPPKSNTGLYAGIAGGALLAGIGFYYYSQGMNPLTAAKSGAQAAKVATNFVPSKEDYQKVYNRIAELLDEAEDYDDGSYGPVVLRLAWHSSGTYDKDTNTGGSNYATMRFEPEALHGANAGLHVARELMEKVKQEFPWISYGDLWTLGGVAAVQEMGGPKIPWRPGRVDGTAEKATPDGRLPDASQGADHLRNIFYRMGFNDQEIVALSGAHALGRCHRDRSGFEGPWTFSPITLTNDYFRLLFDETWVWRKWDGPKQLQDKSTRSLMMLPTDYVLVQDKSFKKYAKQYADDQDLFFKDFANVVSRLFELGVPSEQFVTKEPWIMKNADEKDE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACAGGCTTTTGCGCGCCTCCGCCAGCCACTCCGCGCTGCGTCCCGCCAGATCGCGCGCCCCTCGACGCGGAATGCGACCCCTACTTTCCGAGCGTCATTCAGGCGCTTCAACTCG
ACGGAGGCGCCCAAGCCTCCCAAGTCCAACACCGGGCTTTATGCGGGAATCGCTGGCGGTGCCCTGCTGGCTGGGATCGGTTTCTACTACTATTCGCAGGGAATGAACCCGCTGACGGCG
GCCAAGTCGGGGGCGCAGGCTGCCAAAGTTGCGACCAACTTCGTCCCTTCGAAGGAGGATTATCAGAAG
GTGCGTTGGCGCATTCGTTCCCACGAACCGGTTGCTAAGATGTGTTCGTAG

GTTTACAACCGAATCGCTGAGCTCCTTGATGAAGCGGAGGACTACGATG
GTGAGATCCCTCATTGTATCAATCACACAGCACAGTCTGAATGAGACGCTCGAAAAGACGGCTCATACGGT
CCCGTTGTCCTTCGTCTCGCTTGGCACTCCTCGGGGACGTACGATAAGGACACGAACACGGGCGGCAGCAACTATGCCACCATGCGCTTCGAGCCTGAGGCTCTCCACGGGGCGAACGCG
GGCCTTCACGTTGCGCGCGAGCTCATGGAGAAGGTCAAGCAGGAGTTCCCCTGGATCAGCTATGGGGACCTCTGGACGCTCGGTGGTGTCGCTGCGGTGCAG
GTGAGTTCACAATAGCCG
TGGTATGAGTGTAGCCCTCTGACATCCTCGAAGGAAATGGGCGGCCCGAAAATCCCCTGGAGGCCTGGTCGCGTCGACGGAACGGCTGAGAAGGCGACTCCTGATGGCCGTCTCCCAGAC
GCCTCCCAGGGAGCTGACCACCTGCGCAAC
GTAAGTCCACTTGCATGTATAATGAGTGCTTGACTGACCGAGCGACCAGATCTTCTACCGCATGGGGTATGCCTCGAAGTGCTGAACGCC
TAGGACGAATACTTACACTACCCCCTAGCTTCAACGACCAGGAAATTGTCGCGCTCTCGGGTGCTCACGCGCTTGGCCGCTGCCACCGTGACCGGTCAGTTGAGCTTTGTCATGAATCAC
TCCCTTCACATACTCACACGTTCTACCCAGGTCTGGATTCGAGGGTCCCTGGACTTTCTCGCCCATCACCCTCACGAACGACTACTTCCGCCTTCTCTTTGACGAGACGTGGGTCTGGAG
GAAGTGGGATGGCCCCAAGCAGCTTCAGGACAAGTCCACTCGCTCGCTTATGATGCTTCC
GTAAGTCTTTGCTATCGCTTGGTTCGAGGTCGAACCGTCGCTGACTTAGGTCGACAGGAC
GGACTATGTCCTCGTGCAGGACAAGAGCTTCAAGAAGTACGCGAAGCAGTACGCGGACGATCAGGACCTGTTCTTCAAGGA
GTACGACATACTCTCTTTGCATCGAGTCGTTGATGCTGA
CATGCTCCTAGCTTCGCCAATGTCGTCTCGCGTCTCTTCGAGCTCGGCGTGCCGTCTGAGCAGTTCGTGACCAAGGAGCCTTGGATCATGAAGAACGCGGACGAGAAGGACGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACAGGCTTTTGCGCGCCTCCGCCAGCCACTCCGCGCTGCGTCCCGCCAGATCGCGCGCCCCTCGACGCGGAATGCGACCCCTACTTTCCGAGCGTCATTCAGGCGCTTCAACTCG
ACGGAGGCGCCCAAGCCTCCCAAGTCCAACACCGGGCTTTATGCGGGAATCGCTGGCGGTGCCCTGCTGGCTGGGATCGGTTTCTACTACTATTCGCAGGGAATGAACCCGCTGACGGCG
GCCAAGTCGGGGGCGCAGGCTGCCAAAGTTGCGACCAACTTCGTCCCTTCGAAGGAGGATTATCAGAAG
GTTTACAACCGAATCGCTGAGCTCCTTGATGAAGCGGAGGACTACGATGAC
GGCTCATACGGTCCCGTTGTCCTTCGTCTCGCTTGGCACTCCTCGGGGACGTACGATAAGGACACGAACACGGGCGGCAGCAACTATGCCACCATGCGCTTCGAGCCTGAGGCTCTCCAC
GGGGCGAACGCGGGCCTTCACGTTGCGCGCGAGCTCATGGAGAAGGTCAAGCAGGAGTTCCCCTGGATCAGCTATGGGGACCTCTGGACGCTCGGTGGTGTCGCTGCGGTGCAG
GAAATG
GGCGGCCCGAAAATCCCCTGGAGGCCTGGTCGCGTCGACGGAACGGCTGAGAAGGCGACTCCTGATGGCCGTCTCCCAGACGCCTCCCAGGGAGCTGACCACCTGCGCAAC
ATCTTCTAC
CGCATGGG
CTTCAACGACCAGGAAATTGTCGCGCTCTCGGGTGCTCACGCGCTTGGCCGCTGCCACCGTGACCGGTCTGGATTCGAGGGTCCCTGGACTTTCTCGCCCATCACCCTCACG
AACGACTACTTCCGCCTTCTCTTTGACGAGACGTGGGTCTGGAGGAAGTGGGATGGCCCCAAGCAGCTTCAGGACAAGTCCACTCGCTCGCTTATGATGCTTCC
GACGGACTATGTCCTC
GTGCAGGACAAGAGCTTCAAGAAGTACGCGAAGCAGTACGCGGACGATCAGGACCTGTTCTTCAAGGA
CTTCGCCAATGTCGTCTCGCGTCTCTTCGAGCTCGGCGTGCCGTCTGAGCAG
TTCGTGACCAAGGAGCCTTGGATCATGAAGAACGCGGACGAGAAGGACGAGTAG

Retrieve as FASTA