Entry information : XparPGHS
Entry ID 10749
Creation 2012-03-12 (Christophe Dunand)
Last sequence changes 2012-04-27 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: XparPGHS
Name XparPGHS
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Fungi Ascomycota Lecanoromycetes Teloschistaceae Xanthoria
Organism Xanthoria parietina    [TaxId: 107463 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value XparPGHS
start..stop
S start..stop
HpulPGHS 1087 0 1..624 1..618
AtePGHS01 926 0 1..624 1..616
BdotPGHS 901 0 6..624 5..644
NcPGHS01 895 0 5..624 30..646
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 149892..150383 492 N° 2 150536..151915 1380  
join(149892..150383,150536..151915)


exon

Literature and cross-references XparPGHS
DNA ref. JGI genome:   scaffold_7 (149892..151915)
Cluster/Prediction ref. JGI gene:   57435
Protein sequence: XparPGHS
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   624
PWM (Da):   %s   70167.91  
PI (pH):   %s   7
Sequence 665
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEPVVTPSYKTSLSERLLVNLFHYVNKLVAWHKLPRFVAAINLEALRIELRQYNLLDGYASGAAQGNQSTEPMTDKRFEHARNSDGKFNSTEMPRMGCAGMRFGRNFPRQLTPKPTEEELWNPNPRMLSERFMARKAFIPATSLNLLAAAWIQFQTHDWFAHESSDSNYDIPFPKGDHWPHGKMELPRTKEDEILDKTDLNCPGYKNINTAWWDSSQIYGSSEAATKSLRNMDNDGKLLLTSDGRAQFLPRDADGNPLTGFNNNWWIGMEMLHTLFAMEHNSICDTIRTAHPGWTGDQIFDKARLVNCALMAKIHTVEWTPAILAHPALKIAMNANWWGLVGESLTKLLGRISPTSEVISGIPGSGVNQFGAPYSLTEEFVSVYRMHSLIPDTIAFFSAQSGEHKRTIPVEETLFSKAQSPLKSNDGDKNGMSFADTFYSFGINYPGAITNNNYPSFLRNLTTPDGLHRDMGTVDLLRDRERAVPRYNQFRRLLRMPAPRTFLELTGGNAPLAESLSSAYNGDIETVDALIGSHSEPLPKGFGFSDTAFRIFILMASRRLKSDRFIAGQWNEETYTKEGLKWVQEMGMKDVLGRHFPELKDVLAKSGNAFAPWGMMEASTGYRG

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGCCAGTCGTCACGCCCAGCTACAAGACCAGTCTTAGCGAACGCTTGTTGGTCAATCTTTTCCATTATGTTAACAAATTGGTCGCATGGCACAAGCTCCCACGTTTCGTTGCTGCTA
TCAATCTAGAAGCTCTTCGAATTGAGCTTCGTCAATACAATCTACTCGATGGCTACGCTTCCGGAGCAGCTCAAGGGAATCAGAGCACTGAGCCCATGACTGACAAAAGATTTGAGCATG
CACGAAACTCGGATGGTAAGTTCAATTCCACCGAGATGCCCCGGATGGGCTGCGCTGGGATGCGATTTGGGCGAAACTTTCCGAGGCAATTGACACCCAAGCCGACGGAGGAGGAGCTGT
GGAACCCGAATCCAAGAATGCTGAGCGAGCGGTTTATGGCGCGGAAAGCTTTCATCCCAGCCACGTCGCTGAACCTACTGGCGGCGGCATGGATTCAGTTCCAGACGCATGATTGGTTTG
CCCACGAAAGT
GTACGTTCCGCTTTCATTTTCTTTCCTCGGTGTTGGTCTTCGATCACGGTCTTGGCACATTGTTTCATGGTTATTTCAACTCAAAGCAGAAAGAACCCCAACTTATTAC
GGCAGAGACCTCGATAGGGTCTGCTGATACTGACATTGCACAGAGTGACAGTAATTACGATATACCCTTTCCCAAGGGTGACCATTGGCCACACGGTAAGATGGAGCTGCCACGCACGAA
GGAGGATGAGATCCTAGACAAGACCGATCTCAACTGCCCCGGGTACAAGAACATCAACACAGCATGGTGGGATAGCTCCCAGATCTACGGTTCCAGTGAGGCTGCGACCAAGTCTTTGCG
AAACATGGACAACGACGGCAAGCTTCTCTTGACCAGCGATGGCCGCGCGCAATTCCTCCCTCGCGATGCCGATGGGAACCCTCTCACCGGCTTCAACAACAATTGGTGGATCGGAATGGA
GATGCTGCATACTCTCTTCGCCATGGAGCACAACTCCATCTGCGACACCATCCGCACCGCCCACCCAGGTTGGACCGGTGACCAAATCTTCGACAAAGCCCGCCTCGTCAACTGCGCCCT
CATGGCTAAGATCCACACCGTCGAATGGACCCCCGCTATCCTCGCCCACCCGGCCCTTAAAATTGCCATGAACGCAAATTGGTGGGGTCTCGTCGGCGAATCCCTTACTAAGCTCCTCGG
CCGCATCTCCCCTACTAGCGAAGTCATCAGTGGCATTCCCGGTTCCGGCGTCAACCAATTCGGCGCCCCCTACTCCCTAACCGAGGAATTTGTCTCTGTCTACCGGATGCACTCCTTAAT
CCCCGACACCATCGCCTTCTTCAGCGCCCAGTCCGGAGAGCACAAACGTACCATCCCCGTCGAAGAGACCCTTTTCTCCAAAGCCCAAAGCCCACTGAAAAGCAACGATGGCGATAAAAA
TGGAATGTCCTTCGCAGACACCTTCTACTCCTTCGGCATCAACTACCCCGGCGCCATCACAAACAACAACTACCCATCGTTCCTCCGCAACCTCACCACCCCCGACGGCCTCCACCGCGA
CATGGGGACCGTCGACCTCCTCCGGGACCGCGAACGCGCCGTCCCCCGCTACAACCAATTCCGCCGCCTCCTCCGCATGCCCGCACCGCGCACCTTCCTCGAACTCACCGGCGGCAACGC
CCCACTCGCGGAATCCTTGTCGTCGGCCTACAACGGCGACATCGAAACCGTGGACGCGCTGATTGGGAGCCACAGTGAGCCGTTGCCGAAGGGATTCGGGTTCAGCGACACGGCGTTCCG
TATCTTTATCTTGATGGCGAGTAGACGGTTGAAGAGCGACCGATTCATAGCAGGGCAGTGGAATGAGGAGACGTATACCAAGGAAGGGTTGAAGTGGGTGCAGGAGATGGGGATGAAGGA
TGTTTTGGGAAGACATTTCCCGGAACTTAAGGATGTTTTGGCGAAGAGTGGGAATGCGTTTGCGCCGTGGGGGATGATGGAGGCGAGTACGGGGTATAGAGGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGCCAGTCGTCACGCCCAGCTACAAGACCAGTCTTAGCGAACGCTTGTTGGTCAATCTTTTCCATTATGTTAACAAATTGGTCGCATGGCACAAGCTCCCACGTTTCGTTGCTGCTA
TCAATCTAGAAGCTCTTCGAATTGAGCTTCGTCAATACAATCTACTCGATGGCTACGCTTCCGGAGCAGCTCAAGGGAATCAGAGCACTGAGCCCATGACTGACAAAAGATTTGAGCATG
CACGAAACTCGGATGGTAAGTTCAATTCCACCGAGATGCCCCGGATGGGCTGCGCTGGGATGCGATTTGGGCGAAACTTTCCGAGGCAATTGACACCCAAGCCGACGGAGGAGGAGCTGT
GGAACCCGAATCCAAGAATGCTGAGCGAGCGGTTTATGGCGCGGAAAGCTTTCATCCCAGCCACGTCGCTGAACCTACTGGCGGCGGCATGGATTCAGTTCCAGACGCATGATTGGTTTG
CCCACGAAAGT
AGTGACAGTAATTACGATATACCCTTTCCCAAGGGTGACCATTGGCCACACGGTAAGATGGAGCTGCCACGCACGAAGGAGGATGAGATCCTAGACAAGACCGATCTCA
ACTGCCCCGGGTACAAGAACATCAACACAGCATGGTGGGATAGCTCCCAGATCTACGGTTCCAGTGAGGCTGCGACCAAGTCTTTGCGAAACATGGACAACGACGGCAAGCTTCTCTTGA
CCAGCGATGGCCGCGCGCAATTCCTCCCTCGCGATGCCGATGGGAACCCTCTCACCGGCTTCAACAACAATTGGTGGATCGGAATGGAGATGCTGCATACTCTCTTCGCCATGGAGCACA
ACTCCATCTGCGACACCATCCGCACCGCCCACCCAGGTTGGACCGGTGACCAAATCTTCGACAAAGCCCGCCTCGTCAACTGCGCCCTCATGGCTAAGATCCACACCGTCGAATGGACCC
CCGCTATCCTCGCCCACCCGGCCCTTAAAATTGCCATGAACGCAAATTGGTGGGGTCTCGTCGGCGAATCCCTTACTAAGCTCCTCGGCCGCATCTCCCCTACTAGCGAAGTCATCAGTG
GCATTCCCGGTTCCGGCGTCAACCAATTCGGCGCCCCCTACTCCCTAACCGAGGAATTTGTCTCTGTCTACCGGATGCACTCCTTAATCCCCGACACCATCGCCTTCTTCAGCGCCCAGT
CCGGAGAGCACAAACGTACCATCCCCGTCGAAGAGACCCTTTTCTCCAAAGCCCAAAGCCCACTGAAAAGCAACGATGGCGATAAAAATGGAATGTCCTTCGCAGACACCTTCTACTCCT
TCGGCATCAACTACCCCGGCGCCATCACAAACAACAACTACCCATCGTTCCTCCGCAACCTCACCACCCCCGACGGCCTCCACCGCGACATGGGGACCGTCGACCTCCTCCGGGACCGCG
AACGCGCCGTCCCCCGCTACAACCAATTCCGCCGCCTCCTCCGCATGCCCGCACCGCGCACCTTCCTCGAACTCACCGGCGGCAACGCCCCACTCGCGGAATCCTTGTCGTCGGCCTACA
ACGGCGACATCGAAACCGTGGACGCGCTGATTGGGAGCCACAGTGAGCCGTTGCCGAAGGGATTCGGGTTCAGCGACACGGCGTTCCGTATCTTTATCTTGATGGCGAGTAGACGGTTGA
AGAGCGACCGATTCATAGCAGGGCAGTGGAATGAGGAGACGTATACCAAGGAAGGGTTGAAGTGGGTGCAGGAGATGGGGATGAAGGATGTTTTGGGAAGACATTTCCCGGAACTTAAGG
ATGTTTTGGCGAAGAGTGGGAATGCGTTTGCGCCGTGGGGGATGATGGAGGCGAGTACGGGGTATAGAGGG

Retrieve as FASTA