Entry information : ZmaPrx02 ( Zosma14g00130 [2.2])
Entry ID 10760
Creation 2012-03-15 (Qiang Li)
Last sequence changes 2016-04-06 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-07 (Achraf Jemmat)
Peroxidase information: ZmaPrx02 ( Zosma14g00130 [2.2])
Name (synonym) ZmaPrx02 ( Zosma14g00130 [2.2])
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaPrx02
start..stop
S start..stop
NnPrx10 341 1e-117 15..326 3..320
ZmaPrx36 333 1e-114 11..326 3..316
CagraPrx52 331 1e-113 1..326 1..326
ZmaPrx03 329 5e-113 25..325 11..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62985..63561 577 N° 2 62474..62880 407  
complement(join(62474..62880,62985..63561))


exon

Literature and cross-references ZmaPrx02 ( Zosma14g00130 [2.2])
DNA ref. Phytozome 12:   scaffold_14 (63561..62474)
Cluster/Prediction ref. Phytozome Gene 12:   33175223
Protein sequence: ZmaPrx02 ( Zosma14g00130 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328
PWM (Da):   %s   35784.41  
PI (pH):   %s   4.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSISSSPPLLVTSFIIFVLSIDHHSHLSNGLRQGYYDSTCPNAESIVREVVENAISSQPATAGRLLRLHFHDCFIDGCDGSVLIDHSDGTVERDARGHAGLEGFDVVDRAKDELERQCPEVVSCSDIVALMARDSIVLSGGPDYSVETGRKDGLVSNVEDADDMVEPDDSVDLLTKKFSLRGLSLKDMVVLNAAHTIGTSACFFITERLYGEGRPDSAINPEFVPVLESKCIEGGDNFVRFPLDEGSEMEFDDHFLTNVRDGFTVIRSDAAMYEDRATKSVIDGYIATGKDSFMKDFVDAIVRMGRIGVITDGRDGEIRRTCSSFNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATATCGTCATCTCCTCCTCTCCTTGTCACATCTTTTATCATCTTTGTTCTCTCAATTGATCATCACTCTCATCTCTCCAATGGGCTTCGGCAGGGGTACTACGACTCCACATGT
CCAAACGCTGAGTCCATCGTCAGAGAAGTCGTTGAAAATGCAATCTCTTCTCAACCAGCAACTGCCGGAAGACTCCTCCGTCTCCACTTCCATGACTGCTTCATCGATGGTTGCGATGGG
TCTGTACTGATCGATCATTCCGACGGCACGGTGGAGAGAGATGCACGAGGACATGCTGGACTGGAAGGATTCGATGTTGTGGACAGAGCAAAAGATGAGTTGGAAAGACAGTGTCCTGAG
GTTGTGTCTTGCTCCGATATCGTCGCTCTCATGGCTCGGGATTCCATCGTCCTATCCGGAGGTCCCGATTACAGCGTCGAAACGGGAAGAAAAGATGGGTTGGTCTCCAACGTGGAAGAT
GCTGACGACATGGTCGAGCCGGACGACTCTGTTGATCTTCTAACTAAAAAATTCTCCCTCAGAGGTCTCTCTCTGAAAGACATGGTCGTTCTCAATG
GTATAATTATGATTTTCAACCGT
TTTTAGAATAAATCTGTAATATTATTATCTTTTATAATGGTATTATTCTAAATTATACGTATTTTTTCTTTTTTTTTATAGCCGCTCACACCATCGGAACATCGGCGTGTTTCTTCATCA
CCGAGCGTCTGTACGGAGAAGGAAGACCCGACTCTGCGATAAACCCTGAATTCGTTCCGGTACTGGAGTCTAAATGCATCGAAGGTGGGGATAATTTCGTCAGATTTCCGTTGGATGAAG
GAAGCGAGATGGAATTCGACGACCACTTCTTAACTAATGTAAGAGATGGGTTCACTGTCATAAGATCCGATGCGGCAATGTATGAGGATCGGGCGACAAAATCAGTCATCGACGGGTACA
TAGCTACCGGAAAGGATTCTTTTATGAAGGATTTTGTCGATGCAATCGTACGGATGGGGCGAATCGGAGTTATAACGGACGGTAGAGATGGAGAGATCCGTCGTACGTGTTCTTCCTTTA
ATAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATATCGTCATCTCCTCCTCTCCTTGTCACATCTTTTATCATCTTTGTTCTCTCAATTGATCATCACTCTCATCTCTCCAATGGGCTTCGGCAGGGGTACTACGACTCCACATGT
CCAAACGCTGAGTCCATCGTCAGAGAAGTCGTTGAAAATGCAATCTCTTCTCAACCAGCAACTGCCGGAAGACTCCTCCGTCTCCACTTCCATGACTGCTTCATCGATGGTTGCGATGGG
TCTGTACTGATCGATCATTCCGACGGCACGGTGGAGAGAGATGCACGAGGACATGCTGGACTGGAAGGATTCGATGTTGTGGACAGAGCAAAAGATGAGTTGGAAAGACAGTGTCCTGAG
GTTGTGTCTTGCTCCGATATCGTCGCTCTCATGGCTCGGGATTCCATCGTCCTATCCGGAGGTCCCGATTACAGCGTCGAAACGGGAAGAAAAGATGGGTTGGTCTCCAACGTGGAAGAT
GCTGACGACATGGTCGAGCCGGACGACTCTGTTGATCTTCTAACTAAAAAATTCTCCCTCAGAGGTCTCTCTCTGAAAGACATGGTCGTTCTCAATG
CCGCTCACACCATCGGAACATCG
GCGTGTTTCTTCATCACCGAGCGTCTGTACGGAGAAGGAAGACCCGACTCTGCGATAAACCCTGAATTCGTTCCGGTACTGGAGTCTAAATGCATCGAAGGTGGGGATAATTTCGTCAGA
TTTCCGTTGGATGAAGGAAGCGAGATGGAATTCGACGACCACTTCTTAACTAATGTAAGAGATGGGTTCACTGTCATAAGATCCGATGCGGCAATGTATGAGGATCGGGCGACAAAATCA
GTCATCGACGGGTACATAGCTACCGGAAAGGATTCTTTTATGAAGGATTTTGTCGATGCAATCGTACGGATGGGGCGAATCGGAGTTATAACGGACGGTAGAGATGGAGAGATCCGTCGT
ACGTGTTCTTCCTTTAATAACTAA

Retrieve as FASTA