Entry information : BaDyPrx12
Entry ID 10793
Creation 2012-03-01 (Catherine Mathe)
Last sequence changes 2012-03-27 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-03-27 (Christophe Dunand)
Peroxidase information: BaDyPrx12
Name BaDyPrx12
Class DyP-type peroxidase C    [Orthogroup: DyPrxC001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx12
start..stop
S start..stop
BaDyPrx01 627 0 1..327 1..327
BaDyPrx06 529 0 1..327 1..327
BaDyPrx02 473 4e-167 1..327 1..324
BaDyPrx04 468 2e-165 20..327 1..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12573..12684 112 N° 2 12740..12842 103 N° 3 12898..13231 334 N° 4 13278..13392 115
N° 5 13445..13761 317  
join(12573..12684,12740..12842,12898..13231,13278..13392,13445..13761)


exon

Literature and cross-references BaDyPrx12
DNA ref. JGI genome:   scaffold_45 (12573..13761)
Cluster/Prediction ref. JGI gene:   122578
Protein sequence: BaDyPrx12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (305)
PWM (Da):   %s   34952.81 (32615.7)  
PI (pH):   %s   7.73 (7.76) Peptide Signal:   %s   cut: 23 range:23-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFSLLFASVFAFICASSHVAATSLTERQSRTAPLLGAFPGQAPLPTLAQILGLNATNGTYLPLENIQGDILVGMRKQKERFVFFHVNDATQFKKSLQAYIPARITSCATLISSPNQQPLAFVNLAFSSAGLTALGIKDDLYDARFTSGMFADAQNLGDDLSQWAAPFTGTTIHGVFVIGSDNAFLDQYTSDITSFFGTSLTQVKVMSGSSRPGTNSGHEHFGYLDGISQPAITGWAIDVLPGQAVVPTGVILTGRLGDPMPRPVWAIDGTFMAFRHLQQKVPEFHAYTVANAIRASPAGFLTPQQGAELLGARMFGRWKSGAPL

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTTTCCCTCCTTTTCGCGTCGGTATTCGCGTTCATCTGTGCAAGTAGCCATGTTGCTGCCACCAGCCTCACCGAGAGGCAGTCGCGTACTGCACCGCTGCTTGGTGGTACGTCA
GCTATGCGCCCGTTCAATCAGTCTAGACCTGACCTCATATCGTTCAGCGTTTCCCGGACAAGCTCCCCTGCCTACCCTTGCGCAAATCCTCGGATTGAACGCGACGAACGGGACATACCT
GCCGCTAGAGAACATCCAAGGAGACATATT
GTACGTCGCCTCCTCCCCTCGCGTTCAATCCTGTCGCTAACGCTCGACACTTAAGAGTCGGAATGAGGAAACAAAAAGAACGTTTCGTCT
TTTTCCACGTCAACGACGCGACGCAGTTCAAGAAGTCGCTACAGGCCTATATCCCAGCGCGCATCACATCGTGTGCGACCCTCATTTCATCCCCCAACCAGCAACCGCTCGCGTTCGTCA
ACCTTGCCTTCTCGAGTGCAGGGCTCACTGCGCTTGGGATCAAGGACGACCTCTACGACGCGCGATTCACCTCTGGCATGTTTGCGGACGCGCAAAACCTTGGGGACGATCTCAGCCAAT
GGGCGGCACCTTTTACTGGGACCACTATCCATGGGGTGTTTGTCATAGGGAGCGACCAG
GTGAGTACGATTCGGATGTATTGAGGATCGTACTCATCGATCGTAGAATGCGTTTTTGGAC
CAATACACGAGCGACATTACCTCATTCTTTGGAACCTCCCTCACGCAAGTCAAGGTAATGAGCGGGTCCTCCCGTCCTGGAACCAATTCTGGACACGAGC
GTAAGTCGTTAACACTCTTC
TGCGACAGGTAGCGATCTGACACGCTAGACAGACTTTGGCTACCTCGACGGCATCTCCCAGCCAGCCATCACAGGCTGGGCAATCGACGTCCTCCCAGGTCAAGCCGTCGTGCCCACGGG
GGTCATCCTCACGGGACGTTTGGGCGACCCAATGCCCCGCCCAGTATGGGCCATCGACGGGACCTTCATGGCGTTCCGGCACCTGCAACAGAAAGTGCCCGAGTTTCACGCCTACACGGT
CGCCAACGCCATACGCGCGAGCCCTGCAGGGTTCCTCACACCTCAGCAGGGCGCAGAGCTCCTGGGCGCGCGCATGTTTGGACGTTGGAAGAGCGGTGCACCATTGGAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTTTCCCTCCTTTTCGCGTCGGTATTCGCGTTCATCTGTGCAAGTAGCCATGTTGCTGCCACCAGCCTCACCGAGAGGCAGTCGCGTACTGCACCGCTGCTTGGTGCGTTTCCC
GGACAAGCTCCCCTGCCTACCCTTGCGCAAATCCTCGGATTGAACGCGACGAACGGGACATACCTGCCGCTAGAGAACATCCAAGGAGACATATT
AGTCGGAATGAGGAAACAAAAAGAA
CGTTTCGTCTTTTTCCACGTCAACGACGCGACGCAGTTCAAGAAGTCGCTACAGGCCTATATCCCAGCGCGCATCACATCGTGTGCGACCCTCATTTCATCCCCCAACCAGCAACCGCTC
GCGTTCGTCAACCTTGCCTTCTCGAGTGCAGGGCTCACTGCGCTTGGGATCAAGGACGACCTCTACGACGCGCGATTCACCTCTGGCATGTTTGCGGACGCGCAAAACCTTGGGGACGAT
CTCAGCCAATGGGCGGCACCTTTTACTGGGACCACTATCCATGGGGTGTTTGTCATAGGGAGCGACCAG
AATGCGTTTTTGGACCAATACACGAGCGACATTACCTCATTCTTTGGAACC
TCCCTCACGCAAGTCAAGGTAATGAGCGGGTCCTCCCGTCCTGGAACCAATTCTGGACACGAGC
ACTTTGGCTACCTCGACGGCATCTCCCAGCCAGCCATCACAGGCTGGGCAATCGAC
GTCCTCCCAGGTCAAGCCGTCGTGCCCACGGGGGTCATCCTCACGGGACGTTTGGGCGACCCAATGCCCCGCCCAGTATGGGCCATCGACGGGACCTTCATGGCGTTCCGGCACCTGCAA
CAGAAAGTGCCCGAGTTTCACGCCTACACGGTCGCCAACGCCATACGCGCGAGCCCTGCAGGGTTCCTCACACCTCAGCAGGGCGCAGAGCTCCTGGGCGCGCGCATGTTTGGACGTTGG
AAGAGCGGTGCACCATTGGAC

Retrieve as FASTA