Entry information : ApraVP (mnp02)
Entry ID 10801
Creation 2012-04-03 (Christophe Dunand)
Last sequence changes 2017-04-28 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-28 (Catherine Mathe)
Peroxidase information: ApraVP (mnp02)
Name (synonym) ApraVP (mnp02)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Bolbitiaceae Agrocybe
Organism Agrocybe praecox    [TaxId: 71668 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ApraVP
start..stop
S start..stop
PoVP04_PC15 462 1e-164 10..353 11..354
PcriCIIBB07 460 1e-163 1..353 1..356
PoVP06_PC15 449 3e-159 1..343 1..344
PoVP06_PC9 449 3e-159 1..343 1..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..58 58 N° 2 117..244 128 N° 3 306..364 59 N° 4 421..555 135
N° 5 622..819 198 N° 6 880..916 37 N° 7 971..1059 89 N° 8 1115..1184 70
N° 9 1242..1287 46 N° 10 1349..1521 173 N° 11 1582..1650 69  
join(1..58,117..244,306..364,421..555,622..819,880..916,971..1059,1115..1184,124 2..1287,1349..1521,1582..1650)


exon

Literature and cross-references ApraVP (mnp02)
DNA ref. GenBank:   HQ336220.1
Protein sequence: ApraVP (mnp02)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (333)
PWM (Da):   %s   37245.45 (35097.3)  
PI (pH):   %s   4.46 (4.44) Peptide Signal:   %s   cut: 21 range:21-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLFFAVVLGALELVNGAALKRAACPDGINFANNAACCVLFPVLQDLQTNLFTNGCDEVHDSLRLTFHDAISFSPSKGGGGADGSIMVFEEIEANFFENFGINGIIDTQRPIVDRHSLTPGDFIQFAAAVGITHCPGAPQLNFFMGRPNATAPAPDNLVPEPFDNIGDILARMADAGFSPAELVALLSSHSIASNFIVDPVPGAPFDSTPGIFDNQIFIEVQLRGTTFPGTGGNQGEVMSPVKGEMRLQSDHLARDSRTNCVWQSFAASQPAMAAAFKAAMLKLSILGHKQSDLIDCSDVIPSPLPLVTKPHLPAGQNMKDIEQCASSPFPTFTADPGPATTVPPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGCAATTGTTCTTCGCAGTTGTTCTAGGCGCTCTCGAGTTGGTCAATGGTATGCGCATTTGATTACTATAGAGTTCATCGATGTTATACTCAATTCGCGTTACCAGGTGC
TGCACTGAAGCGAGCCGCCTGCCCTGATGGTATAAATTTCGCCAACAACGCAGCATGTTGCGTGTTGTTCCCAGTACTTCAGGATCTCCAAACGAACCTGTTCACTAACGGATGCGACGA
GGAG
GTAGGACATTCTACAGACATTGTCTCGTAAAAGGGTCCATTGTTGAAGTGCTTCATTTTAGGTGCACGACTCCTTGCGTTTGACGTTCCACGACGCCATCAGTTTCTCTCCTTCCA
AAGG
GTAAGAAAGCACATAATACTCGAATTGATCTTTCTCTACTGAACAATTACATATAGAGGAGGAGGAGCCGATGGGTCCATCATGGTGTTCGAAGAAATTGAAGCCAACTTCTTCGA
GAACTTTGGTATCAACGGTATCATTGACACCCAAAGACCAATCGTGGACAGGCACTCGCTCACGCCTGGTGATTT
GTATGTCCCGACTTCGTTATTTCCGTGCATGTCTTCCGTTTGCTG
ATGGGATTTAATATTTTCTAGCATCCAATTCGCCGCTGCAGTCGGTATCACTCACTGCCCTGGTGCTCCTCAACTTAACTTCTTCATGGGTCGTCCCAATGCCACTGCGCCGGCTCCTGA
TAACTTGGTTCCCGAACCATTCGATAACATTGGTGATATTCTCGCTCGTATGGCCGATGCTGGATTCAGCCCTGCCGAACTTGTTGCTCTTCTTTCTTC
GTAAGTGTGAACTTATCATTC
AATACGGCAATATACATGAGCCTTACTTCTCTTATTCAGGCACTCCATCGCTTCTAACTTCATCGTTGATCCTACTGTATGGCTTTCTCAGTCAGCGCAAGAATTGCATATACTAATAGT
TTGCGTTTAGGTTCCTGGAGCTCCTTTCGATTCGACTCCTGGCATCTTCGATAACCAAATCTTTATCGAAGTCCAACTTCGTGGTACGACCTTCCCAGGGTAAGTACTCGACATACATAC
TTTCCAGCGCCTTTACTAACTCACGACATTTTAGTACTGGAGGAAACCAGGGTGAAGTCATGTCCCCGGTTAAGGGAGAGATGCGTCTCCAATCCGATCACTTGGTGAATAAATCAGCTT
GTCATACTTCGAATATCGAAACTGACTTTCTCACAATACAGCTCGCTCGAGACTCTCGCACCAACTGTGTCTGGCAAAGCTTCGCTGGTAAGTCTCACCGTACTATACTTTTCCTAATAC
GATTTATTAATATTTCTGCGCCACACAGCCAGTCAACCTGCCATGGCTGCCGCATTCAAAGCAGCTATGCTCAAGTTGTCTATCCTCGGACACAAACAATCAGACTTGATCGACTGCTCT
GACGTTATCCCATCGCCTCTTCCTCTCGTCACGAAGCCTCACTTGCCTGCCGGACAAAACATGAAGGATATCGAACAGGGT
GTAAGTGTCTTTGTTCAGTATCGCTGTACTTCCAACTTT
CATTAATACATGATTCAACAGTGTGCCTCCTCTCCCTTCCCCACTTTCACCGCAGATCCCGGTCCGGCCACTACTGTTCCCCCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGCAATTGTTCTTCGCAGTTGTTCTAGGCGCTCTCGAGTTGGTCAATGGTGCTGCACTGAAGCGAGCCGCCTGCCCTGATGGTATAAATTTCGCCAACAACGCAGCATGT
TGCGTGTTGTTCCCAGTACTTCAGGATCTCCAAACGAACCTGTTCACTAACGGATGCGACGAGGAG
GTGCACGACTCCTTGCGTTTGACGTTCCACGACGCCATCAGTTTCTCTCCTTCC
AAAGG
AGGAGGAGGAGCCGATGGGTCCATCATGGTGTTCGAAGAAATTGAAGCCAACTTCTTCGAGAACTTTGGTATCAACGGTATCATTGACACCCAAAGACCAATCGTGGACAGGCAC
TCGCTCACGCCTGGTGATTT
CATCCAATTCGCCGCTGCAGTCGGTATCACTCACTGCCCTGGTGCTCCTCAACTTAACTTCTTCATGGGTCGTCCCAATGCCACTGCGCCGGCTCCTGAT
AACTTGGTTCCCGAACCATTCGATAACATTGGTGATATTCTCGCTCGTATGGCCGATGCTGGATTCAGCCCTGCCGAACTTGTTGCTCTTCTTTCTTC
GCACTCCATCGCTTCTAACTTC
ATCGTTGATCCTACT
GTTCCTGGAGCTCCTTTCGATTCGACTCCTGGCATCTTCGATAACCAAATCTTTATCGAAGTCCAACTTCGTGGTACGACCTTCCCAGGTACTGGAGGAAACCAG
GGTGAAGTCATGTCCCCGGTTAAGGGAGAGATGCGTCTCCAATCCGATCACTTG
CTCGCTCGAGACTCTCGCACCAACTGTGTCTGGCAAAGCTTCGCTGCCAGTCAACCTGCCATGGCT
GCCGCATTCAAAGCAGCTATGCTCAAGTTGTCTATCCTCGGACACAAACAATCAGACTTGATCGACTGCTCTGACGTTATCCCATCGCCTCTTCCTCTCGTCACGAAGCCTCACTTGCCT
GCCGGACAAAACATGAAGGATATCGAACAGGGT
TGTGCCTCCTCTCCCTTCCCCACTTTCACCGCAGATCCCGGTCCGGCCACTACTGTTCCCCCCGTGTAA

Retrieve as FASTA