Entry information : OsPrx71(LOC_Os05g04500)
Entry ID 1081
Creation 2006-07-25 (Filippo Passardi)
Last sequence changes 2006-07-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx71(LOC_Os05g04500)
Name OsPrx71(LOC_Os05g04500)
Class Class III peroxidase    [Orthogroup: Prx174]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Shoots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx71
start..stop
S start..stop
PedPrx05 510 0 40..344 34..339
TaPrx14 496 3e-178 14..344 11..343
HvPrx09 487 2e-174 40..344 36..342
BdiPrx75 478 2e-171 37..344 27..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2020286..2020543 258 N° 2 2020715..2021039 325 N° 3 2021612..2022063 452  
join(2020286..2020543,2020715..2021039,2021612..2022063)


exon

Literature and cross-references OsPrx71(LOC_Os05g04500)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1M2
DNA ref. GenBank:   NC_008398.1 (2020328..2022060)
Protein sequence: OsPrx71(LOC_Os05g04500)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (314)
PWM (Da):   %s   36565.98 (33624.6)  
PI (pH):   %s   4.66 (4.60) Peptide Signal:   %s   cut: 24 range:17-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVSSPAPSSLHVPMAAAALLGMLMMMSSAPEMKVEAAGGLSVGFYAESCPKAEAIVRDTVTKAFEKAPGTPADLIRLFFHDCFVRGCDASVLLESTPGNKAERDNKANNPSLDGFDVVDDAKDLLEKECPHTVSCADILSLVARDSAYLAGGLDFEIPTGRRDGFVSKEDEVLSNVPHPEFGAKDLLKNFTAKGFTAEEMVTLSGAHSIGTSHCSSFTNRLYKYYGTYGTDPSMPAAYAADMKSKCPPETAAQQDATMVQLDDVTPFKMDNQYYRNVLAGNVTFASDVALLDTPETAALVRLYAAGDPAAWLARFAAALVKVSKLDVLTGGEGEIRLNCSRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, intron 1 and 3 (before regular position)) and 8 ESTs. Containing IntR (proximal).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTCTCGTCGCCGGCGCCGTCGTCTCTGCATGTGCCGATGGCCGCTGCGGCACTATTAGGGATGCTGATGATGATGTCGTCGGCGCCGGAGATGAAGGTGGAGGCGGCCGGCGGG
TTGTCCGTCGGGTTCTACGCCGAATCGTGCCCCAAGGCGGAGGCGATCGTCCGGGACACGGTGACCAAGGCGTTCGAGAAGGCGCCCGGCACGCCGGCCGACCTCATCCGCCTCTTCTTC
CACGACTGCTTCGTCCGC
GTAAGTATAGCACCCCGCTTACGTGGATGCATCGTGTCCGTGCCACGTGTGCTCACTAGGCAGCTTTGTGCTTACGTGGACGCACCATGTCGTGCCACGTGT
ACTTAGCTTATGTTGACGCACCATATCGTGCCATGTGTTCTAACTAGGCAGCTATATATGACTCTCTAGGGATGTGACGCATCGGTGTTGCTGGAGTCGACACCAGGGAACAAGGCGGAG
AGGGACAACAAGGCGAACAACCCTAGCTTGGATGGGTTTGACGTCGTCGATGATGCCAAGGACCTCCTCGAGAAGGAGTGTCCACACACCGTCTCTTGCGCCGACATCCTCTCTCTCGTG
GCTCGTGATAGCGCCTACCTTGCTGGTGGGCTCGACTTCGAGATCCCAACAGGTCGTCGTGATGGCTTCGTCTCTAAGGAGGATGAGGTCCTCTCCAACGTCCCTCACCCGGAGTTCGGT
GCCAAAGACCTCCTCAAAAACTTCACCGCTAAAG
GTACATATTATATACTTGTACTACATAGATACGCATATCATCGGTAACAATTTCATGGGGTCATCATATGCACTTGCCAGTTTATC
TAAAGTCTTGTTAATGCTCTCCCTCATACCGATGTCCCATAAATCATCATAGAGCGAGTTATGAATGCAAGATAGTGAGAGTTGTTTAGCTCTGATATACGGAAAGTGTTTTTATCCCTC
GAGAGGATATCCCAACGTTTATGATTGCCACTTAAATAGTTATAAAAGTATGAAAAAAATTAACAAGATAGATTAATATAATATATATCACTCTATAAACATACAAGTTAAAATTTAACT
TTTACAAGTTGTATTAAATATAACTGCAAATGTTCAATAATTATTTTCAATTTAATTTGTTCTTTTGGTTGTAACTCGTAGAGTCGAATTTGACTTTTATGTTTATAGAGTGATATATTT
TAGATATCTATATTTTATATTAAATTATCTTGTCAATTTTTTAAAAAATTTAGTAACTATTTAGATGACATACAACCAACAAAGAAATATCCTCTAATACCATATTAATGATATACGATT
ACTTAGGTTTTACGGCGGAGGAGATGGTGACGCTGTCGGGGGCGCACTCTATCGGCACGTCTCACTGCTCATCGTTCACAAACCGGCTGTACAAGTACTACGGCACGTACGGCACGGACC
CGTCGATGCCGGCGGCGTACGCGGCGGACATGAAGAGCAAGTGCCCGCCGGAGACGGCGGCGCAGCAGGACGCGACGATGGTGCAGCTCGACGACGTGACGCCGTTCAAGATGGACAACC
AGTACTACAGGAACGTGCTCGCCGGGAACGTCACGTTCGCCTCCGACGTGGCCCTCCTCGACACGCCGGAGACGGCGGCGCTCGTCAGGCTCTACGCCGCCGGCGACCCCGCAGCCTGGC
TCGCCCGCTTCGCCGCCGCGCTGGTCAAGGTCAGCAAGCTCGACGTGCTCACCGGCGGCGAGGGGGAGATCAGGCTCAACTGCTCCAGGATCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTCTCGTCGCCGGCGCCGTCGTCTCTGCATGTGCCGATGGCCGCTGCGGCACTATTAGGGATGCTGATGATGATGTCGTCGGCGCCGGAGATGAAGGTGGAGGCGGCCGGCGGG
TTGTCCGTCGGGTTCTACGCCGAATCGTGCCCCAAGGCGGAGGCGATCGTCCGGGACACGGTGACCAAGGCGTTCGAGAAGGCGCCCGGCACGCCGGCCGACCTCATCCGCCTCTTCTTC
CACGACTGCTTCGTCCGC
GGATGTGACGCATCGGTGTTGCTGGAGTCGACACCAGGGAACAAGGCGGAGAGGGACAACAAGGCGAACAACCCTAGCTTGGATGGGTTTGACGTCGTCGAT
GATGCCAAGGACCTCCTCGAGAAGGAGTGTCCACACACCGTCTCTTGCGCCGACATCCTCTCTCTCGTGGCTCGTGATAGCGCCTACCTTGCTGGTGGGCTCGACTTCGAGATCCCAACA
GGTCGTCGTGATGGCTTCGTCTCTAAGGAGGATGAGGTCCTCTCCAACGTCCCTCACCCGGAGTTCGGTGCCAAAGACCTCCTCAAAAACTTCACCGCTAAAG
GTTTTACGGCGGAGGAG
ATGGTGACGCTGTCGGGGGCGCACTCTATCGGCACGTCTCACTGCTCATCGTTCACAAACCGGCTGTACAAGTACTACGGCACGTACGGCACGGACCCGTCGATGCCGGCGGCGTACGCG
GCGGACATGAAGAGCAAGTGCCCGCCGGAGACGGCGGCGCAGCAGGACGCGACGATGGTGCAGCTCGACGACGTGACGCCGTTCAAGATGGACAACCAGTACTACAGGAACGTGCTCGCC
GGGAACGTCACGTTCGCCTCCGACGTGGCCCTCCTCGACACGCCGGAGACGGCGGCGCTCGTCAGGCTCTACGCCGCCGGCGACCCCGCAGCCTGGCTCGCCCGCTTCGCCGCCGCGCTG
GTCAAGGTCAGCAAGCTCGACGTGCTCACCGGCGGCGAGGGGGAGATCAGGCTCAACTGCTCCAGGATCAACTAA

Retrieve as FASTA