Entry information : AbHalPrx05_bisporus
Entry ID 10810
Creation 2012-04-10 (Christophe Dunand)
Last sequence changes 2012-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbHalPrx05_bisporus
Name AbHalPrx05_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx05_bisporus
start..stop
S start..stop
AbHalPrx03_bisporus 478 6e-170 1..370 1..371
AbHalPrx04_bisporus 467 1e-165 1..371 1..373
LbiHalPrx05 428 2e-150 20..371 30..386
AdelHalPrx01 358 5e-123 5..354 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 615952..616224 273 N° 2 615842..615899 58 N° 3 615622..615792 171 N° 4 615495..615568 74
N° 5 614895..615434 540  
complement(join(614895..615434,615495..615568,615622..615792,615842..615899,6159 52..616224))


exon

Literature and cross-references AbHalPrx05_bisporus
DNA ref. JGI genome:   scaffold_3 (616224..614895)
Cluster/Prediction ref. GenPept:   183842
Protein sequence: AbHalPrx05_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (351)
PWM (Da):   %s   40195.76 (38048.5)  
PI (pH):   %s   4.67 (4.59) Peptide Signal:   %s   cut: 21 range:21-371
Sequence 413
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNPFLKLAVLALVTAPLAGAFPSHRSLGGLSSEQLDRIFPTLKVAPPEGPPPPQDDTSTRLVDDADHPFMPAGPNDMRGPCPGLNTLASHGYLPRNGIATPAQVINATMQGFNMEFSLAKFVTYAAFLVDGNPITNLMSIGGKSDLTGEDPPDPATVGGLNTHAVFEGDASMTRADAFFGDNHSFNQTLWDGFVDFSNRFGAGKYNLTVATELRIQRIQDSIATNPQFSFVSPRFITAYAESTFPINFFIDGRQQDGQLDLDAAISFFRDMRYPSGFFRAPKPMGVEGIETIIAAHPIPAGANNGAVNTYTPDPHSGDFNSFCTVYTNFVNETIRGLYPSPTGILKDSLNRNLDFLHDFVSGCPQIFPWGR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCCTTTCTCAAACTTGCTGTGCTAGCCTTGGTAACTGCACCATTAGCAGGGGCCTTCCCGTCCCATCGCTCCCTTGGTGGCCTCTCTTCAGAACAATTGGATAGAATTTTTCCA
ACGCTCAAGGTAGCTCCTCCGGAAGGTCCTCCGCCGCCTCAGGACGATACGTCGACCAGATTGGTTGATGACGCTGATCATCCATTTATGCCGGCGGGTCCGAATGACATGCGTGGGCCT
TGCCCTGGACTCAATACCCTTGCATCCCACGGG
GTAATTTATCTCTTCGTCTACTCCCAATGCAAATTCACATCCGTCATGACAGTACCTGCCCCGGAATGGAATTGCAACTCCCGCTCA
AGTCATCAATGCTACAATGCAAG
GCGAGTAATTTACAGTTTTTCCTGGAAATCTGGTACTAAAAATTTGCAGGTTTCAACATGGAGTTCTCCCTTGCAAAGTTTGTCACATACGCCGCAT
TCCTGGTAGATGGCAATCCCATTACCAACTTGATGAGTATCGGAGGAAAAAGCGACCTCACTGGTGAAGACCCTCCCGACCCTGCAACGGTCGGTGGTTTGAACACACACGCTGTATTCG
AAG
GTGCTGTGTCTTTTTGAGGGTCGTGGGTTGTATTTAACGATAGGTTCATATAGGTGATGCCAGCATGACCCGGGCCGATGCGTTCTTTGGGGATAACCACAGCTTTAATCAAACATT
GTGGGATGGG
GTACGTACGGTCGTTCTTTGATATTCTTCAATTACTCATATGTCCACCTTTCTCTTTCAGTTTGTCGACTTCAGTAACCGATTTGGTGCCGGGAAATACAACCTAACGGT
GGCCACTGAACTTCGGATCCAAAGAATCCAGGACTCAATCGCAACAAACCCACAATTCTCATTCGTTTCTCCCCGTTTCATCACAGCCTACGCGGAATCTACCTTTCCTATCAACTTTTT
CATTGACGGTCGTCAGCAGGACGGTCAGCTCGACCTCGATGCTGCTATCAGCTTCTTCCGTGATATGAGGTATCCGTCAGGTTTCTTCAGAGCTCCTAAACCAATGGGCGTCGAGGGTAT
CGAGACTATTATAGCTGCTCATCCCATTCCTGCCGGCGCAAACAACGGCGCTGTCAACACCTATACTCCCGACCCTCACTCTGGGGATTTCAATTCGTTCTGCACGGTATACACCAACTT
CGTCAATGAAACGATTAGAGGTTTATATCCTTCGCCGACGGGTATATTGAAAGACAGCTTGAACCGAAACTTGGATTTCCTTCACGATTTTGTATCAGGTTGCCCACAAATCTTCCCGTG
GGGGAGATA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCCTTTCTCAAACTTGCTGTGCTAGCCTTGGTAACTGCACCATTAGCAGGGGCCTTCCCGTCCCATCGCTCCCTTGGTGGCCTCTCTTCAGAACAATTGGATAGAATTTTTCCA
ACGCTCAAGGTAGCTCCTCCGGAAGGTCCTCCGCCGCCTCAGGACGATACGTCGACCAGATTGGTTGATGACGCTGATCATCCATTTATGCCGGCGGGTCCGAATGACATGCGTGGGCCT
TGCCCTGGACTCAATACCCTTGCATCCCACGGG
TACCTGCCCCGGAATGGAATTGCAACTCCCGCTCAAGTCATCAATGCTACAATGCAAGGTTTCAACATGGAGTTCTCCCTTGCAAAG
TTTGTCACATACGCCGCATTCCTGGTAGATGGCAATCCCATTACCAACTTGATGAGTATCGGAGGAAAAAGCGACCTCACTGGTGAAGACCCTCCCGACCCTGCAACGGTCGGTGGTTTG
AACACACACGCTGTATTCGAAG
GTGATGCCAGCATGACCCGGGCCGATGCGTTCTTTGGGGATAACCACAGCTTTAATCAAACATTGTGGGATGGGTTTGTCGACTTCAGTAACCGATTT
GGTGCCGGGAAATACAACCTAACGGTGGCCACTGAACTTCGGATCCAAAGAATCCAGGACTCAATCGCAACAAACCCACAATTCTCATTCGTTTCTCCCCGTTTCATCACAGCCTACGCG
GAATCTACCTTTCCTATCAACTTTTTCATTGACGGTCGTCAGCAGGACGGTCAGCTCGACCTCGATGCTGCTATCAGCTTCTTCCGTGATATGAGGTATCCGTCAGGTTTCTTCAGAGCT
CCTAAACCAATGGGCGTCGAGGGTATCGAGACTATTATAGCTGCTCATCCCATTCCTGCCGGCGCAAACAACGGCGCTGTCAACACCTATACTCCCGACCCTCACTCTGGGGATTTCAAT
TCGTTCTGCACGGTATACACCAACTTCGTCAATGAAACGATTAGAGGTTTATATCCTTCGCCGACGGGTATATTGAAAGACAGCTTGAACCGAAACTTGGATTTCCTTCACGATTTTGTA
TCAGGTTGCCCACAAATCTTCCCGTGGGGGAGATA

Retrieve as FASTA