Entry information : PinvHalPrx02
Entry ID 10813
Creation 2012-04-13 (Christophe Dunand)
Last sequence changes 2012-04-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-13 (Christophe Dunand)
Peroxidase information: PinvHalPrx02
Name PinvHalPrx02
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Paxillaceae Paxillus
Organism Paxillus involutus    [TaxId: 71150 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PinvHalPrx02
start..stop
S start..stop
PinvHalPrx01 506 0 1..291 1..291
SlutHalPrx05 406 2e-144 1..286 1..286
SbreHalPrx05 400 4e-142 1..273 1..273
SbreHalPrx01 371 1e-130 1..279 1..279
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 497110..497332 223 N° 2 497394..497597 204 N° 3 497659..497872 214 N° 4 497929..498163 235
join(497110..497332,497394..497597,497659..497872,497929..498163)


exon

Literature and cross-references PinvHalPrx02
DNA ref. JGI genome:   scaffold_11 (497110..498163)
Cluster/Prediction ref. JGI gene:   168544
Protein sequence: PinvHalPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   292
PWM (Da):   %s   32110.13  
PI (pH):   %s   6.88
Sequence 333
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLLSSVSNAFYDAGVMTWDAFLTLGNLVRFSRPVGKVTPEGHPGFGGYWPEYIPPREGDGRCCCPGLNAMANHGIIPRNGKGIKFTELTSLINSTYNFGPAFCSFTVHYAARMLNRSYSNGSFDLEEINLHNGIEHDGSLTRLDTALSPDQSSPHVPFVEDLLTFASGKDAEGRDLFTIKDISRILGKRRAEARAANKDYTLALFHRVFSSANSSTLLTIFGGRKDDLKTILLEERLPQGWESRVRKPYGLTMLTLNWTALPVEFGIRESDWASDAKQDAKAIQSDGEGA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGCTTCTCAGCTCTGTCTCTAACGCTTTCTATGATGCCGGCGTTATGACCTGGGACGCCTTCCTTACGCTGGGTAACCTCGTGCGGTTCAGCCGTCCTGTTGGAAAAGTTACGCCCG
AGGGCCATCCAGGCTTTGGCGGATATTGGCCGGAGTACATACCACCTCGAGAAGGTGATGGTAGATGTTGCTGCCCAGGTCTCAACGCAATGGCCAATCACG
GTAAGTTCACAGTTTTGC
AAGATCTGTGGCGATAATCGGTAAACTGATTTTATTCTGTTAGGAATCATTCCGCGCAATGGCAAGGGAATCAAGTTCACCGAACTTACTTCTCTGATCAACTCGACGTACAACTTTGGA
CCTGCATTCTGCTCTTTTACGGTGCACTATGCCGCGCGCATGCTGAATAGGAGCTATAGCAACGGCTCATTTGACTTGGAGGAAATCAACTTGCACAATGGCATCGAACACGATGGGTCG
CTCACCC
GTACGCAATTCACCCGTGATTCTTCTAAGGGACTCAGTCTTGATCCTTGGCTTAATTCTAGGACTTGACACAGCGCTGTCTCCCGATCAATCATCGCCACATGTCCCCTTCGT
CGAAGATCTGCTCACTTTCGCCAGTGGCAAAGATGCGGAGGGGAGAGATCTATTCACCATCAAAGACATATCCCGAATTCTCGGCAAGCGCCGAGCAGAGGCAAGGGCAGCTAATAAGGA
CTACACCCTGGCCCTATTCCACAGGGTGTTTAGTAGTGCCAA
GTGCGTTCTTTCACTACTGGATTTTTTTTGACGACTGAAGCCTTCATTGGGGGTAGTTCATCGACCTTGCTTACCATC
TTCGGTGGTCGGAAGGACGATCTCAAGACGATTCTTCTCGAGGAGCGATTGCCTCAAGGCTGGGAATCTCGCGTTCGCAAGCCCTACGGGCTGACCATGCTCACGTTGAACTGGACTGCC
CTTCCAGTGGAATTTGGCATTCGAGAATCTGATTGGGCATCGGATGCGAAACAGGATGCCAAGGCGATCCAGAGTGACGGTGAAGGCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGCTTCTCAGCTCTGTCTCTAACGCTTTCTATGATGCCGGCGTTATGACCTGGGACGCCTTCCTTACGCTGGGTAACCTCGTGCGGTTCAGCCGTCCTGTTGGAAAAGTTACGCCCG
AGGGCCATCCAGGCTTTGGCGGATATTGGCCGGAGTACATACCACCTCGAGAAGGTGATGGTAGATGTTGCTGCCCAGGTCTCAACGCAATGGCCAATCACG
GAATCATTCCGCGCAATG
GCAAGGGAATCAAGTTCACCGAACTTACTTCTCTGATCAACTCGACGTACAACTTTGGACCTGCATTCTGCTCTTTTACGGTGCACTATGCCGCGCGCATGCTGAATAGGAGCTATAGCA
ACGGCTCATTTGACTTGGAGGAAATCAACTTGCACAATGGCATCGAACACGATGGGTCGCTCACCC
GACTTGACACAGCGCTGTCTCCCGATCAATCATCGCCACATGTCCCCTTCGTCG
AAGATCTGCTCACTTTCGCCAGTGGCAAAGATGCGGAGGGGAGAGATCTATTCACCATCAAAGACATATCCCGAATTCTCGGCAAGCGCCGAGCAGAGGCAAGGGCAGCTAATAAGGACT
ACACCCTGGCCCTATTCCACAGGGTGTTTAGTAGTGCCAA
TTCATCGACCTTGCTTACCATCTTCGGTGGTCGGAAGGACGATCTCAAGACGATTCTTCTCGAGGAGCGATTGCCTCAAG
GCTGGGAATCTCGCGTTCGCAAGCCCTACGGGCTGACCATGCTCACGTTGAACTGGACTGCCCTTCCAGTGGAATTTGGCATTCGAGAATCTGATTGGGCATCGGATGCGAAACAGGATG
CCAAGGCGATCCAGAGTGACGGTGAAGGCGCCTGA

Retrieve as FASTA