Entry information : PplLDS01-2
Entry ID 10818
Creation 2012-04-17 (Catherine Mathe (Scipio))
Last sequence changes 2016-02-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-11 (Achraf Jemmat)
Peroxidase information: PplLDS01-2
Name PplLDS01-2
Class Linoleate diol synthase (PGHS like)    [Orthogroup: LDS001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Postia
Organism Postia placenta    [TaxId: 104341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PplLDS01-2
start..stop
S start..stop
PplLDS01-1 2042 0 1..1004 1..1004
JargLDS01 1118 0 7..1004 5..1066
LbiLDS01 969 0 15..1004 14..1069
CcinLDS01 904 0 4..1004 1..1085
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..177 177 N° 2 242..304 63 N° 3 363..447 85 N° 4 506..778 273
N° 5 852..1007 156 N° 6 1066..1175 110 N° 7 1234..1452 219 N° 8 1517..1681 165
N° 9 1744..1826 83 N° 10 1890..1924 35 N° 11 1978..2111 134 N° 12 2173..2206 34
N° 13 2262..2305 44 N° 14 2361..2408 48 N° 15 2459..2597 139 N° 16 2653..2978 326
N° 17 3031..3210 180 N° 18 3261..3346 86 N° 19 3399..3519 121 N° 20 3571..3856 286
N° 21 3917..3921 5 N° 22 3973..4016 44 N° 23 4073..4100 28 N° 24 4150..4229 80
N° 25 4279..4387 109  
join(1..177,242..304,363..447,506..778,852..1007,1066..1175,1234..1452,1517..168 1,1744..1826,1890..1924,1978..2111,2173..2206,2262..2305,2361..2408,2459..2597,2 653..2978,3031..3210,3261..3346,3399..3519,3571..3856,3917..3921,3973..4016,4073 ..4100,4150..4229,4279..4387)


exon

Literature and cross-references PplLDS01-2
DNA ref. JGI genome:   scaffold_37 (22368..26751)
Protein sequence: PplLDS01-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1009
PWM (Da):   %s   110441.72  
PI (pH):   %s   5.97
Sequence 1050
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVNLNPVLNPLKNTIDFVAESDAPVDQDGGHPLPPLLARKITDVEQEAIRGPGFTPADLPAYINAVKTLNGPGLDDRKFLLEKVLTLMARAPDDSAFAATLQKFAIDILYKDLPHPPSGYLALPSGAPPTASPITKGVKYAYRSADGSDYNVLIPTLGMAGTPYARSVPSTTRIPPQYLPDPGLVFDTLLKREKFVEHPGGISSLFFAFADLVIHSIFNTNTRDWTINDASSYLDLSPLYGSSQAQVDSVRRKDGTGRLYEDVFADPRLLFMPPASCALLVLFCRNHNYVAERILAINELGSYRAPSTLGAQERAAQDEELFQRARLVNSALFMQVILGDYVGAILGLTRDGLAWRLDPLAAMRELNHAFAPQGEGNVVAVEFNLMYRWHATSSASDTQWIENLFGKLFPGKSWSDISVNDFRTAIIKYVMGTPQDVKEWSFDNLKRGPDGRYDDAELANILQSATEAPASAFGARGTPEVLRVIEILGIMQARSWGTCSLNEFRSFMGLKPYSTFAEWNPDPKIYKAAEALYHDIDNLELYAGLQAEETKVPMPGAGLCPGYTISRAILADAVCLTRGDRFLTVDLTPFNLTTWGYQDCQYKKDDGSIGGILSKLLFRTLPNQYPADSAYAFFPFMVPKTMKGHVAADAVNKYSWDRPALAAPVTSLLGPSVSAPVSEYDQRLKAILGGVVPDRAAVRQVLFSDASIQQWAQSFQEITQQLLKTKSVDHVDSKAKYVNIVRNVVNVLPVVWISNFIVGLPLKTETNPHGVYREHDLLTKWSDVGNYVFLDQSPEGQFALRGKCTETAKDVTGFVKGHCAELSGHSLSGFADSVVDYVTGGNEHERSFIKSLLAGRHGSHDALAAGVIAEVVATAPLYSRILAEVVDYYLDDGKRARLVSVLTGESANRDEKLLALIREALPTGDVQKLDAARSVDFGLLDHRFLAKTAFTVLRTIFSLKDLKRAPGSSGSLNRFADDTNGELRPVYLTSQGSVTPWPVSMLVQVGFTH

Retrieve as FASTA  
Remarks Complete sequence from genomic (24 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTCAACCTGAACCCCGTTCTCAACCCGCTCAAGAATACCATCGACTTTGTTGCCGAGAGCGACGCCCCCGTCGACCAGGATGGCGGGCACCCCCTCCCTCCTCTACTCGCCCGCAAAA
TCACGGACGTCGAGCAGGAAGCTATCCGTGGGCCCGGCTTCACTCCCGCCGACCTG
GTAAGCCACCGGTATATCGTCGGACTTATGCGCTGAATGTAGCTCACAACCTTTTGCGCCTTAG

CCTGCATATATCAACGCCGTAAAGACTCTCAATGGCCCTGGTCTTGACGACCGCAAGTTCCTG
GTGAGCATCCCGGGCCTATTGAGTGTTGCTGGCAACGTCCGACGACGCGTACCTGCA
GCTCGAGAAGGTGCTCACGCTCATGGCGCGCGCCCCGGACGACTCGGCCTTCGCGGCAACGCTTCAAAAGTTCGCGATTGACATCCGTGAGCGCATATATGCGGTGAAAGTAGCGCCCAC
TGTTCTGACCGATATGCATACTAGTGTACAAGGACCTGCCTCATCCCCCGAGCGGGTACCTGGCCCTCCCCAGTGGCGCGCCCCCGACTGCATCGCCGATCACTAAGGGCGTGAAGTACG
CCTACCGCAGCGCCGACGGCTCCGACTACAATGTCCTCATCCCTACCTTGGGCATGGCCGGCACGCCATACGCGCGCTCTGTGCCCTCCACCACGCGCATCCCCCCGCAGTATCTCCCCG
ACCCGGGCCTCGTCTTCGACACGCTCCTCAAACGCGAGAAGTTTGTCGAACATCCAG
GTACGTGCGCCGCCTGCGCTTCCCTCTCTTTCTTGCGTATATATATTCAGGCTCATGATGTCA
TGCCCTGCAGGCGGCATATCGAGCCTGTTCTTCGCCTTTGCCGACCTCGTCATCCACAGCATCTTCAACACCAACACGCGCGACTGGACCATCAACGACGCCTCCAGCTACCTCGACCTC
AGCCCCCTCTACGGCAGCTCCCAGGCGCAGGTCGACAGTGTTCGCC
GTAAGCCCTCTCGCGCACTTCAGTGCACACCTGCTGACTGTACGCGTGACGTTCGCAGGCAAGGACGGCACTGG
TAGGCTCTACGAGGACGTCTTTGCCGACCCGCGACTGCTCTTCATGCCCCCCGCGTCGTGCGCGCTGCTCGTCCTCTTCTGCCGCAACCACAAT
GTAAGCCCCCAATCCGTTTGCCCCTC
GCGGCACGGGACTCACCGCGCTTGGCACGCAGTACGTCGCCGAGAGGATCCTCGCCATCAACGAGCTCGGGAGTTATCGCGCGCCCAGCACGCTCGGCGCGCAGGAGCGCGCGGCGCAGG
ACGAGGAGCTCTTCCAGCGCGCCCGCCTCGTCAACAGCGCGCTCTTCATGCAGGTCATCCTGGGCGACTACGTCGGCGCGATCCTTGGCCTCACGCGCGACGGCCTCGCGTGGCGCCTCG
ACCCGCTCGCG
GTGCGTCTGTGTATGCGTGGGCGCGTGTGTGCATGTGCTGACGCGCGATCGGCGCCCCCCGCAGGCGATGCGCGAGCTCAACCACGCGTTCGCGCCGCAGGGCGAGGGC
AACGTCGTCGCGGTTGAGTTCAACCTGATGTACCGCTGGCATGCGACGAGCTCCGCGTCCGACACGCAGTGGATCGAGAACCTCTTTGGAAAGCTCTTCCCGGGGAAGTCGTGGAGTGAC
GTAAGCACCTTCATCGCGCGCGTGCGCGCGTGCGGGTGTCTGACCTCGGTCTTATGGGACAGATCTCCGTTAATGACTTCCGCACCGCCATCATCAAGTATGTGATGGGCACGCCGCAGG
ACGTGAAGGAGTGGTCGTTTGACAA
GTAAGGAAATCCGCGCTTCGTGCCGGTGTATTGTTGGATTGAAGGAAATCCCTTTATGAACAGCCTGAAGCGTGGTCCGGACGGCCGTTACGACG
ACG
GTGGGTGTGCACTCTCCCACGGGCGAGCGCGTTCGCTGACGACGTGTTTGCAGCGGAGCTCGCGAACATCCTGCAGAGCGCGACCGAGGCCCCCGCGAGTGCGTTCGGGGCGCGCGG
CACGCCCGAGGTACTGCGCGTGATCGAGATCCTCGGCATCATGCAGGCTAGGAGCTGGGGGACGTGCTCG
GTGCGTGCCATATCGATTCCGTCGCACCCTGCGGAAGTCTGATGCATATG
CTATCCGCCAGTTGAACGAGTTCAGGAGCTTCATGGGCCTGAAGCGTGAGTGCCAGCAGCTGGCAAGGGTAATCGGGACAATCAGCTGACGCGTTTACAGCTTATAGCACCTTCGCGGAG
TGGAACCCCGATCCAAAGATCTAC
GTACGCGACCTTTTCATCACGCTCCGCTGGGTCAGATCGCTGACGCCCGCTGTAGAAGGCAGCGGAAGCCTTGTACCACGACATCGACAACCTGGA
GCTTTAC
GTAGGGACACTCCTTTGGGAAACGTACTTTTGACTGAGCCTTGTGTGTAGGCTGGACTGCAAGCAGAGGAGACCAAGGTGCCGATGCCAGGTGCAGGCCTGTGCCCGGGTTAC
ACAATCTCGCGCGCGATCCTGGCGGATGCTGTATGCCTCACTCGTGGCGACCGCTTCCTCACTGTGGACCTCACGC
GTAAGTCCGTTCCAGAAACCACCCTGCTGAACCTGGCACTCACG
CGCCGTTCCAGCGTTCAACCTCACGACCTGGGGCTACCAGGACTGCCAGTATAAGAAGGATGACGGCTCGATCGGCGGCATCCTGTCCAAGCTGCTCTTCCGCACGCTGCCGAACCAGTA
CCCCGCCGACTCTGCGTACGCGTTCTTCCCGTTCATGGTGCCCAAGACGATGAAGGGCCACGTCGCGGCGGACGCGGTGAACAAGTACTCCTGGGACAGGCCTGCGCTGGCTGCCCCGGT
CACCTCGCTGCTGGGCCCCAGCGTGTCCGCTCCCGTCTCGGAGTATGATCAGCGTCTCAAGGCAATCTTGGGCGGCGTTGTGCCTGACCGAGCGGCG
GTATGCAGCCCCTCCTGCGTTGA
TGTGGTGGTGCCTGATGGTAGCGGCATAGGTTCGGCAAGTTCTCTTCAGCGACGCGTCCATCCAGCAATGGGCACAGTCCTTCCAGGAGATCACGCAGCAGCTGCTGAAGACAAAGTCGG
TGGATCACGTTGACAGCAAGGCGAAATACGTCAACATCGTCCGCAATGTCGTCAACGTGCTTCCCGTCGTCTGGATCTCCAACTTCATC
GTGCGTTCCTACGTCTCATGTATTGTCGCCG
CTGTCTCACGTAGAACTAGGTCGGGCTCCCTCTGAAGACGGAGACAAACCCCCACGGCGTATACCGTGAACATGACCTCCTGACAAAGTGGTCAGACGTTGGAAAGTTTGTATCGTTGTA
TGCGTCTGTTGATGATAACCTGATTGCGTGACATCAGCTATGTTTTCCTGGATCAATCTCCCGAAGGCCAGTTTGCGCTTCGCGGAAAGTGTACCGAGACCGCCAAGGACGTCACCGGTT
TCGTTAAAGGTCATTGTGCCGAGCTTTCCGGCCACAGC
GTACGTTCCGCGCGCTCTGAACTCGTGTTCAACACTAACGAATATGTGCAGCTGTCTGGATTCGCAGATTCTGTCGTCGACT
ACGTCACAGGAGGGAATGAGCACGAGAGATCATTTATTAAGTCGCTGCTTGCTGGGCGACACGGCTCGCATGATGCCCTCGCTGCGGGTGTGATCGCCGAAGTGGTCGCTACCGCACCAC
TCTACTCCCGAATCCTGGCTGAAGTCGTTGATTACTACCTCGATGATGGCAAACGCGCTCGTCTCGTCTCAGTCCTAACTGGCGAGTCAGCGAACCGCGACGAGAAACTACTCGCGCTCA
TCCGAGAGGCTCTCC
GTAAGTGCTCTTTGAGCTTGTTATACCATCGCCCTTACTGAATTATGTTGGACATTGTAGCTACCGTATGTGTAAACGTTTGTCAGACACGATGCTGCATTACTC
ATTCGTTACAGGGGGATGTGCAGAAGCTCGACGCTGCTAGATCAGTGGATTTCGGGTATGCTACACTCTACATTAGCTTATATTACCATTGCTCACTCAATTTTCCACTAGTCTGCTTGA
TCACAGGTTCCTCGCAAAG
GTAAGGCAGCCGCAACTAATCACTCAGCTTATATTGACCTCGTCACCAGACGGCTTTCACGGTATTGCGAACAATCTTCTCCCTTAAGGATCTCAAGCGGG
CACCTGGTTCCTCGGGTAGTCTGAACCG
GTAAGTTATTTGTGATCGAAATTGGGTGTGTATGTTCATGCCGTCGCAGATTCGCGGACGACACGAACGGCGAGTTGCGTCCCGTCTACCTG
ACCTCCCAGGGATCGGTGACACCATGGCCAGTGTCAATGCTAGTTCAAGTAGGTTTCACCCATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTCAACCTGAACCCCGTTCTCAACCCGCTCAAGAATACCATCGACTTTGTTGCCGAGAGCGACGCCCCCGTCGACCAGGATGGCGGGCACCCCCTCCCTCCTCTACTCGCCCGCAAAA
TCACGGACGTCGAGCAGGAAGCTATCCGTGGGCCCGGCTTCACTCCCGCCGACCTG
CCTGCATATATCAACGCCGTAAAGACTCTCAATGGCCCTGGTCTTGACGACCGCAAGTTCCTGC
TCGAGAAGGTGCTCACGCTCATGGCGCGCGCCCCGGACGACTCGGCCTTCGCGGCAACGCTTCAAAAGTTCGCGATTGACATCC
TGTACAAGGACCTGCCTCATCCCCCGAGCGGGTACC
TGGCCCTCCCCAGTGGCGCGCCCCCGACTGCATCGCCGATCACTAAGGGCGTGAAGTACGCCTACCGCAGCGCCGACGGCTCCGACTACAATGTCCTCATCCCTACCTTGGGCATGGCCG
GCACGCCATACGCGCGCTCTGTGCCCTCCACCACGCGCATCCCCCCGCAGTATCTCCCCGACCCGGGCCTCGTCTTCGACACGCTCCTCAAACGCGAGAAGTTTGTCGAACATCCAG
GCG
GCATATCGAGCCTGTTCTTCGCCTTTGCCGACCTCGTCATCCACAGCATCTTCAACACCAACACGCGCGACTGGACCATCAACGACGCCTCCAGCTACCTCGACCTCAGCCCCCTCTACG
GCAGCTCCCAGGCGCAGGTCGACAGTGTTCGCC
GCAAGGACGGCACTGGTAGGCTCTACGAGGACGTCTTTGCCGACCCGCGACTGCTCTTCATGCCCCCCGCGTCGTGCGCGCTGCTCG
TCCTCTTCTGCCGCAACCACAAT
TACGTCGCCGAGAGGATCCTCGCCATCAACGAGCTCGGGAGTTATCGCGCGCCCAGCACGCTCGGCGCGCAGGAGCGCGCGGCGCAGGACGAGGAGC
TCTTCCAGCGCGCCCGCCTCGTCAACAGCGCGCTCTTCATGCAGGTCATCCTGGGCGACTACGTCGGCGCGATCCTTGGCCTCACGCGCGACGGCCTCGCGTGGCGCCTCGACCCGCTCG
CG
GCGATGCGCGAGCTCAACCACGCGTTCGCGCCGCAGGGCGAGGGCAACGTCGTCGCGGTTGAGTTCAACCTGATGTACCGCTGGCATGCGACGAGCTCCGCGTCCGACACGCAGTGGA
TCGAGAACCTCTTTGGAAAGCTCTTCCCGGGGAAGTCGTGGAGTGAC
ATCTCCGTTAATGACTTCCGCACCGCCATCATCAAGTATGTGATGGGCACGCCGCAGGACGTGAAGGAGTGGT
CGTTTGACAA
CCTGAAGCGTGGTCCGGACGGCCGTTACGACGACGCGGAGCTCGCGAACATCCTGCAGAGCGCGACCGAGGCCCCCGCGAGTGCGTTCGGGGCGCGCGGCACGCCCGAGG
TACTGCGCGTGATCGAGATCCTCGGCATCATGCAGGCTAGGAGCTGGGGGACGTGCTCG
TTGAACGAGTTCAGGAGCTTCATGGGCCTGAAGCCTTATAGCACCTTCGCGGAGTGGAACC
CCGATCCAAAGATCTAC
AAGGCAGCGGAAGCCTTGTACCACGACATCGACAACCTGGAGCTTTACGCTGGACTGCAAGCAGAGGAGACCAAGGTGCCGATGCCAGGTGCAGGCCTGTGCC
CGGGTTACACAATCTCGCGCGCGATCCTGGCGGATGCTGTATGCCTCACTCGTGGCGACCGCTTCCTCACTGTGGACCTCACGC
CGTTCAACCTCACGACCTGGGGCTACCAGGACTGCC
AGTATAAGAAGGATGACGGCTCGATCGGCGGCATCCTGTCCAAGCTGCTCTTCCGCACGCTGCCGAACCAGTACCCCGCCGACTCTGCGTACGCGTTCTTCCCGTTCATGGTGCCCAAGA
CGATGAAGGGCCACGTCGCGGCGGACGCGGTGAACAAGTACTCCTGGGACAGGCCTGCGCTGGCTGCCCCGGTCACCTCGCTGCTGGGCCCCAGCGTGTCCGCTCCCGTCTCGGAGTATG
ATCAGCGTCTCAAGGCAATCTTGGGCGGCGTTGTGCCTGACCGAGCGGCG
GTTCGGCAAGTTCTCTTCAGCGACGCGTCCATCCAGCAATGGGCACAGTCCTTCCAGGAGATCACGCAGC
AGCTGCTGAAGACAAAGTCGGTGGATCACGTTGACAGCAAGGCGAAATACGTCAACATCGTCCGCAATGTCGTCAACGTGCTTCCCGTCGTCTGGATCTCCAACTTCATC
GTCGGGCTCC
CTCTGAAGACGGAGACAAACCCCCACGGCGTATACCGTGAACATGACCTCCTGACAAAGTGGTCAGACGTTGGAAA
CTATGTTTTCCTGGATCAATCTCCCGAAGGCCAGTTTGCGCTTC
GCGGAAAGTGTACCGAGACCGCCAAGGACGTCACCGGTTTCGTTAAAGGTCATTGTGCCGAGCTTTCCGGCCACAGC
CTGTCTGGATTCGCAGATTCTGTCGTCGACTACGTCACAGGAG
GGAATGAGCACGAGAGATCATTTATTAAGTCGCTGCTTGCTGGGCGACACGGCTCGCATGATGCCCTCGCTGCGGGTGTGATCGCCGAAGTGGTCGCTACCGCACCACTCTACTCCCGAA
TCCTGGCTGAAGTCGTTGATTACTACCTCGATGATGGCAAACGCGCTCGTCTCGTCTCAGTCCTAACTGGCGAGTCAGCGAACCGCGACGAGAAACTACTCGCGCTCATCCGAGAGGCTC
TCC
CTACCGGGGATGTGCAGAAGCTCGACGCTGCTAGATCAGTGGATTTCGGTCTGCTTGATCACAGGTTCCTCGCAAAGACGGCTTTCACGGTATTGCGAACAATCTTCTCCCTTAAGG
ATCTCAAGCGGGCACCTGGTTCCTCGGGTAGTCTGAACCG
ATTCGCGGACGACACGAACGGCGAGTTGCGTCCCGTCTACCTGACCTCCCAGGGATCGGTGACACCATGGCCAGTGTCAA
TGCTAGTTCAAGTAGGTTTCACCCATTAG

Retrieve as FASTA