Entry information : ZmaAPx-R ( Zosma4g01780 [2.2])
Entry ID 10861
Creation 2012-05-03 (Qiang Li)
Last sequence changes 2016-04-06 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-07 (Achraf Jemmat)
Peroxidase information: ZmaAPx-R ( Zosma4g01780 [2.2])
Name (synonym) ZmaAPx-R ( Zosma4g01780 [2.2])
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaAPx-R
start..stop
S start..stop
VvAPx-R 338 2e-115 95..383 55..328
AfpAPx-R 335 2e-114 101..383 64..330
AcoAPx-R 335 2e-114 107..383 68..328
EgrAPx-R 335 3e-114 146..383 103..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1308981..1309266 286 N° 2 1308014..1308170 157 N° 3 1307665..1307792 128 N° 4 1307373..1307443 71
N° 5 1307197..1307239 43 N° 6 1307023..1307119 97 N° 7 1306811..1306894 84 N° 8 1306174..1306295 122
N° 9 1305953..1306019 67 N° 10 1305150..1305255 106  
complement(join(1305150..1305255,1305953..1306019,1306174..1306295,1306811..1306 894,1307023..1307119,1307197..1307239,1307373..1307443,1307665..1307792,1308014. .1308170,1308981..1309266))


exon

Literature and cross-references ZmaAPx-R ( Zosma4g01780 [2.2])
DNA ref. Phytozome 12:   scaffold_14 (1309292..1304887)
Cluster/Prediction ref. Phytozome Gene 12:   33175403
Protein sequence: ZmaAPx-R ( Zosma4g01780 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   387
PWM (Da):   %s   42381.39  
PI (pH):   %s   6.01
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDMVSTLAAVRCCFNSSSSVAHAAVPVKIARVPLSIGSNISTGVVETAEEDDDEEKYDRDGWFENQIVVADTNKKWRTSINEHSGGGKRGGGEVNDACSDYVNSSVFNGRRVFMYSMLTSTIPILLSHGAHASIPPTSPLTERQPSQQIDTFQTLTIRTEIRKVLTKLKSAGILRLVFHDAGTFDLKEKKGGMNGSIIYELERPENVGLSKSVKVLEKVKDEVDKLFPVSWADLIAVAGSEAVFICGGPFIPVQIGRDDARSTDPSGKLPLESFDASALKKCFMEKGFSTQELVVLSGAHTLGTKGFGNPFVFDNSYFKILLEKPSASPSEMLSMIGLPSDRALSMDENCLRWIKIYADDQMRFFDDFTNAYTKLVNSGTLWKKTE*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATATGGTGTCGACTTTAGCTGCAGTTCGATGTTGTTTCAATTCATCGTCATCTGTTGCGCATGCGGCGGTTCCGGTGAAAATAGCCAGGGTTCCACTATCCATTGGATCCAATATC
AGTACTGGTGTTGTAGAAACGGCGGAAGAAGATGATGATGAAGAAAAATACGACAGGGACGGGTGGTTCGAGAATCAGATCGTGGTTGCAGACACAAACAAAAAGTGGAGAACAAGTATT
AACGAACATAGTGGAGGAGGAAAAAGAGGAGGAGGAGAAGTTAATG
GTAATCTGTTTTATTTATTTTGCTTATTCTTTCATTGGATTATAGTTTTGTTTTATGCCACCTCCTATCATAGG
TTTTTGTTGGTTTCTATATAAGGTTTAGCACAGTAAGAGAGAATATTTCCCAATGTTCCAGATATGCTCTATATTCCACTATGCCAATGTTAAGTATAAATCAGCCTGTAAATGGTATAT
CGAAATATGTATTCGTATCCGTTTTTGAATTCGAATATGTCATATATGGATTTTCGGATTGGATCTGGATTCGGATACCATTATCCGGACGGATTCGGATATCTGCAATATCCGTCATTA
AAATCCGAATTCGGTTGATAATTCCGGATTCGGATATCTGGATATCCGAATAAATATAAATTGACTTCCCTGATTTTAGGGTGATTAATTGACTATTAATTAACTTTATTAAGGGTGATT
AATTGACTATTAATTAACTTTATTAAGGGTGATTTTATATTTTTATAATTTTATTTTAAGATTTTTATAAAAAGTTATCCGGATTTGGATTTTCCGGATATCTGGAAATTTATCCAAATT
TGGATTCGGATTTTCCTATCCGGATATTATTCCGACGGATTCGGATTATCCAGATATTATCCAGATTCGGATTATCCAGATATTATCCAGATTCGGATATCAGGGTATCCGAGCCGAATC
CGATCGATATATAGGCCTAAATATAAGTGTGACTTCTGTACGGACCATGTGGTCCATCTAACTTATATCAATACATATACATTCATGTAAATATAGCTAATGCTAATATTCTAAAATTTT
GATTTCTTGTCTACAGATGCTTGTAGTGACTATGTTAACTCTTCTGTATTCAATGGAAGAAGAGTGTTTATGTATTCGATGCTAACATCAACAATACCGATTCTTCTTTCTCATGGGGCA
CATGCTTCTATTCCTCCTACTTCTCCTTTAACAGAACGACAGCCTTCGCAACA
GTATGTATATAATTTTATTATTCCTCTGTATTTCTCCTTTAACAGAACGACAGCCTTCGCAACAGTA
TGTATATAATTTTATTATTCCTCTGTATTTATCTTTTTAACTTTTACAATGCAGCAATAATTATCAACGTATATTTGCATATTTCATTGTCATTCTATGTGTTTTCTCTTCTTCTTTTGA
CACGATCCTTCATTCCTTTGTGTGTTTATGAAAGGATAGATACTTTTCAGACATTAACTATTCGTACAGAAATTAGGAAAGTCTTGACCAAGTTAAAATCTGCTGGTATTCTCCGATTGG
TTTTCCATGATGCAGGGACCTTTGATTTAAAAGAAAAAAAAG
GTTGTTCTTTTTCTTCTTAATTGATGTCATTATATATAATTTGGTTTATCTCGTCTATCGATTGTGCAATGTTTATGT
CGTGTATTTGAAATTTTGTTTATAATTGTTACCAATTGACATTTCTCTATTTCATATATAATGAAACTTTACATTACCCTTAGGAGCCAGTATATTAAATCATATTTTAATTACAATTGT
TTCATTTGTTTCTTTTGTTCTAGGTGGTATGAATGGTTCCATCATATATGAACTTGAGAGACCAGAAAACGTGGGCCTTAGTAAGTCAGTAAAGGCACGTGTCTTTCTTCTTAATATCAA
TTATTCAAGCTTCTAGAAATCCATAATCCTTATTCTTTTTTCTATGACCATGACTTCATTTTTAGTTTAATTTGTTCTGAGTTAAAATTCCTTTTTTTATCTTTTAGGTTTTAGAGAAAG
TGAAGGATGAAGTGGATAAATTATTCCCAG
GTACGCACAAAACATGCTCTTCCAAATAAATTAAGTTCCTATTCTTATCTATATCGCCATACATTTATCAACTTTAGTATCCTGGGCGGA
CTTAATTGCCGTGGCTGGTTCTGAAGCAGTCTTTATATGTGGGGGGCCTTTCATTCCCGTTCAGATAGGCAGGGATGATGCAAG
GTATAATATTTTATTACAAAAAAAATTATATACAGA
CCAATTTAGCAGTAACTTCTGCATACAGAATCGTATGCAGAAATTTCTTAATTGATCCTTAATATCTATCTTAATTTGTAATGTGCATGTAGATCTACTGATCCGTCTGGGAAGCTTCCT
CTAGAATCATTTGATGCTTCTGCTCTAAAGAAATGTTTTATGGAAAAAGGATTTTC
GTGAGTACATTATTCATTGAAATACATTAAGAAAAATTCTCAAGCTTCTTTTTATGAAGAAAGA
ATATATTTTTACTATTATTAAATAATACTAGTTAAAAACTTCAAACTGATACAGAGGATTATTTTATCATAGGATTATTTTATCATGTGAATACAGAGAATTGTAAATGTGTATTTGTTA
ATATTGATAAACTACCTAGGATAAATTATAAAACTACTTAGAAACTTAAAATAGGCTGGTGGTTATAGATTCCACTCAAAACATAAAACCATAGGACTTAGAACATAAAATATAAGTGCA
AAGTTTTAATTTACTTGATAAATGTAAATATGGAATTATAATTTTATCAAGTATATTCTCATCAACAATGCAGTCCTTGTAATTTCAATGTTCAAATCTCTATTATGTACAAGTATTGAA
TGTTAATGTTCGGATAAAAGGTCAAAAAATCACTTTTATCTTTTTCTCACAACCTCTGCCAATGTATAATATTTATGAGATCCATTTGCAGGACCCAAGAACTCGTTGTACTATCAGGTG
CACATACATTAGGAACCAAAGGCTTTGGAAATCCTTTTGTTTTTGACAATTCTTACTTCAAGATACTTCTGGAAAAACCATCGGCATCCCCAA
GTGAGTGATTCAGAATTCATTTCTGAA
TGACGTTGTCATTTGGTTGCTTTTGGAAGAAAAAATATACAGTATATTTAAACCTGTCTTTATTCTTTAATAACATATTCGTAGATTTGATCACGTGATTCACATCAGAATACATGTGGA
TGTGCAGGTGAAATGTTGAGTATGATTGGCCTTCCCTCAGATCGGGCTCTATCCATGGATGAAAATTGTTTGAGGTATGTACTGTTTATTTTTGTTGTTTTTTATTAATTATTTGAAATT
TTCAATCATGTAATTAGGATTGCAGCCTATACTACCCCTTGGGGATTACTATGGAATGTCATTGAATGTTTGTCGTGACATATGCTACCCCTTGGGGATTACTTTGGATCATCTTCTGTT
GTATTTTTTTATGTTCTCCACATGTAATCAGGGTTGCCCTTAATTTTTACAATGAAAAATTAAATAGCTTTCTAAAAAATTCCATAGTCTGGTTAACATACCATATACTCATAACTCGGT
AAATTTCATAAGCCATTACTCCTCTTGCTGACACTTTCTTCACAAGAGGACCACCTCCCCTCAACCATCTGTTTTGCTGCATCATACAAAACCAAGAAGAGGAGTTGACCTTATGAGGGT
TGGAATGGATGTATAGTTTTGCAGAATGAGGCCGATGTGTCTTGGAAAATGGGGGTTGAAGTATACTATTTATGTTTGTATTTGTACAGCTCAGGCCCTTAGCCACTATCATCACCGTGT
GTAATGTATTTGATTCTGCTTCTGAAATTATGAGCCTGATAAGCTTGTTTTGGGTTTAGTGGTTGTTTTGATAATCACGATTATTAAATATTAATCTTGCATTAAAATATGAAATTATTG
TGAATTGTTTGGCTATCCCACTTTAAATAACAGATATTTTGTTTTATATAGGTGGATTAAGATTTATGCAGATGATCAGATGAGATTTTTTGACGATTTTACCAATGCATACACAAAACT
TGTGAACTCTGGTACTTTGTGGAAAAAAACAGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATATGGTGTCGACTTTAGCTGCAGTTCGATGTTGTTTCAATTCATCGTCATCTGTTGCGCATGCGGCGGTTCCGGTGAAAATAGCCAGGGTTCCACTATCCATTGGATCCAATATC
AGTACTGGTGTTGTAGAAACGGCGGAAGAAGATGATGATGAAGAAAAATACGACAGGGACGGGTGGTTCGAGAATCAGATCGTGGTTGCAGACACAAACAAAAAGTGGAGAACAAGTATT
AACGAACATAGTGGAGGAGGAAAAAGAGGAGGAGGAGAAGTTAATG
ATGCTTGTAGTGACTATGTTAACTCTTCTGTATTCAATGGAAGAAGAGTGTTTATGTATTCGATGCTAACATCA
ACAATACCGATTCTTCTTTCTCATGGGGCACATGCTTCTATTCCTCCTACTTCTCCTTTAACAGAACGACAGCCTTCGCAACA
GATAGATACTTTTCAGACATTAACTATTCGTACAGAA
ATTAGGAAAGTCTTGACCAAGTTAAAATCTGCTGGTATTCTCCGATTGGTTTTCCATGATGCAGGGACCTTTGATTTAAAAGAAAAAAAAG
GTGGTATGAATGGTTCCATCATATATGAA
CTTGAGAGACCAGAAAACGTGGGCCTTAGTAAGTCAGTAAAG
GTTTTAGAGAAAGTGAAGGATGAAGTGGATAAATTATTCCCAGTATCCTGGGCGGACTTAATTGCCGTGGCTGGTTCT
GAAGCAGTCTTTATATGTGGGGGGCCTTTCATTCCCGTTCAGATAGGCAGGGATGATGCAAG
ATCTACTGATCCGTCTGGGAAGCTTCCTCTAGAATCATTTGATGCTTCTGCTCTAAAG
AAATGTTTTATGGAAAAAGGATTTTC
GACCCAAGAACTCGTTGTACTATCAGGTGCACATACATTAGGAACCAAAGGCTTTGGAAATCCTTTTGTTTTTGACAATTCTTACTTCAAGATA
CTTCTGGAAAAACCATCGGCATCCCCAA
GTGAAATGTTGAGTATGATTGGCCTTCCCTCAGATCGGGCTCTATCCATGGATGAAAATTGTTTGAGGTGGATTAAGATTTATGCAGATGAT
CAGATGAGATTTTTTGACGATTTTACCAATGCATACACAAAACTTGTGAACTCTGGTACTTTGTGGAAAAAAACAGAGTGA

Retrieve as FASTA