Entry information : OsPrx78(LOC_Os06g20150)
Entry ID 1088
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx78(LOC_Os06g20150)
Name OsPrx78(LOC_Os06g20150)
Class Class III peroxidase    [Orthogroup: Prx048]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Leaves
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx78
start..stop
S start..stop
OsPrx80 541 0 1..330 1..324
SiPrx30 516 0 1..330 1..329
SbPrx145 509 0 1..330 1..329
SbPrx131 505 0 20..330 23..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11402430..11402651 222 N° 2 11402749..11403522 774  
join(11402430..11402651,11402749..11403522)


exon

Literature and cross-references OsPrx78(LOC_Os06g20150)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z4D3
DNA ref. GenBank:   NC_008399.1 (11402430..11403519)
Protein sequence: OsPrx78(LOC_Os06g20150)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (307)
PWM (Da):   %s   35207.71 (32911.4) Transmb domain:   %s   i7-26o
PI (pH):   %s   6.65 (6.36) Peptide Signal:   %s   cut: 25 range:25-331
Sequence 372
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISRCCVALLLLVVLVAAGSAAAAADQLRVDYYRETCPNVEAIVRDEMEKIIGAAPSLAGPLLRLHFHDCFVRGCDASVLLSSTAGNVAERDAKPNKSLRGFGSVERVKARLEAACPGTVSCADVLTLMARDAVVLARGPTWPVALGRRDGRVSAAGEAAASLPPADGDIATLLRIFAANDLDIKDLAVLSGAHTLGTAHCPSYAGRLYNFTGKNDADPSLDGEYAGRLRARCASATDESGMISEMDPGSYKTFDTSYYRHVAKRRGLFSSDASLLTDATTRDYVRRIATGKFDAEFFSDFGESMTKMGNVQVLTGEEGEIRKKCYVINS

Retrieve as FASTA  
Remarks chromosome 6. 16 ESTs. Rice blast fungus interaction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGATCTCCAGGTGTTGTGTCGCGCTGCTGCTGCTCGTGGTGCTTGTCGCCGCGGGCTCTGCGGCCGCGGCGGCTGACCAGCTCCGCGTCGACTACTACCGCGAGACGTGCCCGAACG
TCGAGGCCATCGTCCGCGACGAGATGGAGAAGATCATCGGCGCCGCCCCCAGCCTCGCCGGCCCGCTCCTCCGCCTCCATTTCCACGACTGCTTCGTCCGG
GTACGTACTCCGGTCGCCG
GCGTCGTGTCGCGTCGCGTGCACGGCGGCGCCATTGATTGATCGATCGATCGATGTCGTGTTTTTTTGCAATTTGCAGGGGTGCGACGCGTCCGTGCTGCTCAGCTCCACCGCGGGGAAC
GTGGCGGAGCGCGACGCGAAGCCGAACAAGAGCCTGCGCGGGTTCGGCTCCGTGGAGCGGGTGAAGGCGAGGCTGGAGGCGGCGTGCCCGGGCACCGTGTCGTGCGCCGACGTGCTCACG
CTCATGGCGCGCGACGCCGTCGTGCTGGCGCGGGGCCCCACCTGGCCGGTCGCCCTGGGGAGGAGGGACGGCAGGGTGTCCGCCGCCGGCGAGGCCGCCGCCAGCCTGCCACCCGCCGAC
GGCGACATCGCGACGCTCCTCAGGATCTTCGCCGCCAACGACCTCGACATCAAGGACCTCGCCGTGCTCTCCGGCGCGCACACCCTCGGCACGGCGCACTGCCCGTCCTACGCCGGCAGG
CTCTACAACTTCACCGGCAAGAACGACGCCGACCCGTCGCTGGACGGCGAGTACGCCGGCAGGCTGAGGGCCAGGTGCGCGAGCGCCACCGACGAGTCCGGCATGATCTCCGAGATGGAC
CCGGGCAGCTACAAGACGTTCGACACCAGCTACTACCGCCATGTCGCGAAGCGGAGGGGGCTCTTCTCCTCCGACGCGTCGCTGCTCACCGACGCCACCACCAGGGACTACGTGCGGCGG
ATCGCCACCGGCAAGTTCGACGCCGAGTTCTTCAGCGACTTCGGCGAGTCCATGACCAAGATGGGCAACGTCCAGGTGCTCACCGGGGAGGAAGGAGAGATCAGGAAGAAGTGCTACGTC
ATCAACTCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGATCTCCAGGTGTTGTGTCGCGCTGCTGCTGCTCGTGGTGCTTGTCGCCGCGGGCTCTGCGGCCGCGGCGGCTGACCAGCTCCGCGTCGACTACTACCGCGAGACGTGCCCGAACG
TCGAGGCCATCGTCCGCGACGAGATGGAGAAGATCATCGGCGCCGCCCCCAGCCTCGCCGGCCCGCTCCTCCGCCTCCATTTCCACGACTGCTTCGTCCGG
GGGTGCGACGCGTCCGTGC
TGCTCAGCTCCACCGCGGGGAACGTGGCGGAGCGCGACGCGAAGCCGAACAAGAGCCTGCGCGGGTTCGGCTCCGTGGAGCGGGTGAAGGCGAGGCTGGAGGCGGCGTGCCCGGGCACCG
TGTCGTGCGCCGACGTGCTCACGCTCATGGCGCGCGACGCCGTCGTGCTGGCGCGGGGCCCCACCTGGCCGGTCGCCCTGGGGAGGAGGGACGGCAGGGTGTCCGCCGCCGGCGAGGCCG
CCGCCAGCCTGCCACCCGCCGACGGCGACATCGCGACGCTCCTCAGGATCTTCGCCGCCAACGACCTCGACATCAAGGACCTCGCCGTGCTCTCCGGCGCGCACACCCTCGGCACGGCGC
ACTGCCCGTCCTACGCCGGCAGGCTCTACAACTTCACCGGCAAGAACGACGCCGACCCGTCGCTGGACGGCGAGTACGCCGGCAGGCTGAGGGCCAGGTGCGCGAGCGCCACCGACGAGT
CCGGCATGATCTCCGAGATGGACCCGGGCAGCTACAAGACGTTCGACACCAGCTACTACCGCCATGTCGCGAAGCGGAGGGGGCTCTTCTCCTCCGACGCGTCGCTGCTCACCGACGCCA
CCACCAGGGACTACGTGCGGCGGATCGCCACCGGCAAGTTCGACGCCGAGTTCTTCAGCGACTTCGGCGAGTCCATGACCAAGATGGGCAACGTCCAGGTGCTCACCGGGGAGGAAGGAG
AGATCAGGAAGAAGTGCTACGTCATCAACTCGTAG

Retrieve as FASTA