Entry information : OsPrx79(LOC_Os06g27850)
Entry ID 1089
Creation 2006-07-25 (Filippo Passardi)
Last sequence changes 2006-07-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx79(LOC_Os06g27850)
Name OsPrx79(LOC_Os06g27850)
Class Class III peroxidase    [Orthogroup: Prx107]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Flowers
Mixed tissues
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx79
start..stop
S start..stop
BdiPrx29 487 2e-173 17..390 1..370
SiPrx42 482 2e-171 47..353 18..324
SbPrx132 481 1e-170 22..357 5..340
ZmPrx23 476 2e-168 40..353 29..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1555832..15559117 14003286 N° 2 15559229..15560134 906  
join(1555832..15559117,15559229..15560134)


exon

Literature and cross-references OsPrx79(LOC_Os06g27850)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1L4
DNA ref. GenBank:   NC_008399.1 (15558890..15560131)
Protein sequence: OsPrx79(LOC_Os06g27850)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   393 (352)
PWM (Da):   %s   42183.16 (37963.1) Transmb domain:   %s   i7-28o
PI (pH):   %s   6.62 (6.26) Peptide Signal:   %s   cut: 26 range:26-377
Sequence 434
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHGYGTRRSDSGGDRSMARLSTAAWPFLAAVAAALLCSVDAVIVEGLQVGFYNQTCPSAEEAVRDVVTSEIGLDRTIAAGIIRIFFHDCFVTGCDASILLDETPSGDVPEKESSANGFTLHGLRTLDVAKSTVESMCPRTVSCADILAFAARDAAVAAGIPFYEVAAGRMDGLRSNMDDLPGNMPTPSHQVPRMSELFVKRGLSQEDLVVLSGAHSIGGAHCFMFSNRIYGFSQGADIDPALEPAFAEKLRKVCPPRKDGDDPEQSPKVSFDGRTSEKLDNVYYSELLASRGLMTSDDALIKDPETKTTVDLFAGDNAVWQEKFAAAMQKLGAVDVLVGEGKGQIRKQCRLVNKPSKQSKPTSTRQSMPALRPKRKKPRLGLGNFIPGFHGFF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 2 exons) and 30 ESTs. Mainly expressed in flower.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCATGGGTACGGTACGCGCCGGTCGGACTCCGGTGGTGATCGATCAATGGCGAGGCTCTCAACAGCTGCGTGGCCGTTCCTGGCCGCAGTGGCGGCGGCGCTGCTGTGCTCCGTCGACG
CGGTGATCGTCGAAGGCCTCCAGGTTGGGTTCTACAACCAGACGTGCCCGTCGGCGGAGGAGGCCGTCCGTGACGTCGTCACCTCGGAGATCGGCTTGGACCGCACCATCGCCGCCGGCA
TCATCCGCATCTTCTTCCACGACTGCTTCGTCACGGTATAACACTAACAGTACACATGTGTGTTGTCCGTACGTACGTGTGATCAATCACCTTAATATTGGTATTACGTTGAAGAATCGA
TCGATCGTTGATGGATGGATATATAGGGATGCGACGCGTCCATCCTCCTCGACGAGACGCCGTCCGGCGACGTCCCGGAGAAGGAATCGTCGGCGAACGGCTTCACCCTCCACGGGCTGA
GGACGCTGGACGTGGCCAAGTCCACCGTGGAGTCCATGTGCCCGCGCACCGTGTCGTGCGCGGACATCCTCGCGTTCGCGGCGCGCGACGCCGCCGTGGCCGCGGGGATCCCCTTCTACG
AAGTGGCGGCGGGGCGGATGGACGGCCTGCGCTCCAACATGGACGACCTGCCGGGGAACATGCCGACGCCCAGCCACCAAGTCCCGCGGATGTCGGAGCTCTTCGTCAAGCGCGGCCTGT
CGCAGGAGGACCTCGTCGTGCTCTCCGGCGCGCACTCCATCGGCGGCGCCCACTGCTTCATGTTCTCCAACCGCATCTACGGCTTCTCCCAGGGCGCCGACATCGACCCGGCGCTGGAGC
CGGCGTTCGCCGAGAAGCTCCGGAAGGTGTGCCCGCCGCGGAAGGACGGCGACGACCCGGAGCAGTCGCCCAAGGTCAGCTTCGACGGCCGCACGTCGGAGAAGCTCGACAACGTCTACT
ACTCCGAGCTGCTGGCCAGCCGCGGCCTCATGACCTCCGACGACGCGCTCATCAAGGACCCCGAGACCAAGACCACCGTCGATCTCTTCGCCGGAGACAACGCCGTGTGGCAGGAGAAGT
TCGCCGCCGCGATGCAGAAGCTCGGCGCCGTCGACGTGCTCGTCGGCGAGGGCAAGGGCCAGATAAGGAAGCAATGCCGGCTGGTCAACAAGCCGTCCAAGCAGTCCAAGCCCACGTCGA
CGCGGCAGTCCATGCCGGCGTTGCGGCCAAAGCGCAAGAAGCCTCGCTTGGGCTTGGGCAATTTCATCCCTGGCTTCCACGGCTTCTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCATGGGTACGGTACGCGCCGGTCGGACTCCGGTGGTGATCGATCAATGGCGAGGCTCTCAACAGCTGCGTGGCCGTTCCTGGCCGCAGTGGCGGCGGCGCTGCTGTGCTCCGTCGACG
CGGTGATCGTCGAAGGCCTCCAGGTTGGGTTCTACAACCAGACGTGCCCGTCGGCGGAGGAGGCCGTCCGTGACGTCGTCACCTCGGAGATCGGCTTGGACCGCACCATCGCCGCCGGCA
TCATCCGCATCTTCTTCCACGACTGCTTCGTCACGGTATAACACTAACAGTACACATGTGTGTTGTCCGTACGTACGTGTGATCAATCACCTTAATATTGGTATTACGTTGAAGAATCGA
TCGATCGTTGATGGATGGATATATAGGGATGCGACGCGTCCATCCTCCTCGACGAGACGCCGTCCGGCGACGTCCCGGAGAAGGAATCGTCGGCGAACGGCTTCACCCTCCACGGGCTGA
GGACGCTGGACGTGGCCAAGTCCACCGTGGAGTCCATGTGCCCGCGCACCGTGTCGTGCGCGGACATCCTCGCGTTCGCGGCGCGCGACGCCGCCGTGGCCGCGGGGATCCCCTTCTACG
AAGTGGCGGCGGGGCGGATGGACGGCCTGCGCTCCAACATGGACGACCTGCCGGGGAACATGCCGACGCCCAGCCACCAAGTCCCGCGGATGTCGGAGCTCTTCGTCAAGCGCGGCCTGT
CGCAGGAGGACCTCGTCGTGCTCTCCGGCGCGCACTCCATCGGCGGCGCCCACTGCTTCATGTTCTCCAACCGCATCTACGGCTTCTCCCAGGGCGCCGACATCGACCCGGCGCTGGAGC
CGGCGTTCGCCGAGAAGCTCCGGAAGGTGTGCCCGCCGCGGAAGGACGGCGACGACCCGGAGCAGTCGCCCAAGGTCAGCTTCGACGGCCGCACGTCGGAGAAGCTCGACAACGTCTACT
ACTCCGAGCTGCTGGCCAGCCGCGGCCTCATGACCTCCGACGACGCGCTCATCAAGGACCCCGAGACCAAGACCACCGTCGATCTCTTCGCCGGAGACAACGCCGTGTGGCAGGAGAAGT
TCGCCGCCGCGATGCAGAAGCTCGGCGCCGTCGACGTGCTCGTCGGCGAGGGCAAGGGCCAGATAAGGAAGCAATGCCGGCTGGTCAACAAGCCGTCCAAGCAGTCCAAGCCCACGTCGA
CGCGGCAGTCCATGCCGGCGTTGCGGCCAAAGCGCAAGAAGCCTCGCTTGGGCTTGGGCAATTTCATCCCTGGCTTCCACGGCTTCTTCTGA

Retrieve as FASTA