Entry information : EglPrx91
Entry ID 10912
Creation 2012-05-04 (Qiang Li)
Last sequence changes 2012-05-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-22 (Christophe Dunand)
Peroxidase information: EglPrx91
Name EglPrx91
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus globulus    [TaxId: 34317 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EglPrx91
start..stop
S start..stop
EgrPrx91 810 0 1..399 1..399
EcamPrx91 808 0 1..399 1..399
EguPrx91 805 0 1..399 1..399
PpePrx50 477 7e-170 66..395 8..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..342 342 N° 2 436..633 198 N° 3 976..1141 166 N° 4 1247..1740 494
join(1..342,436..633,976..1141,1247..1740)


exon

Literature and cross-references EglPrx91
Protein sequence: EglPrx91
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   399 (378)
PWM (Da):   %s   43768.62 (41467.4) Transmb domain:   %s   i5-22o
PI (pH):   %s   5.25 (5.25) Peptide Signal:   %s   cut: 22 range:22-399
Sequence 440
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNSLNGWIVIFVLLVSFLASFRNRKGSSADQRGRPFDPPFSLDPLSPVLLQRNDDGAAVDDEDPALGLQYDFYRNTCPAAEEIVRSSMSRIYSQHPDVAPAFLRLLFHDCFIRGCDASVLLDDSHGNRSHPTERQAIPNRTLKGFDRIDTIKQELEDHCPGVVSCADVLVLATREGILLAGGPFYPLFTGRRDSIQSYYADAMAEIPKPDDNVFRTLHLFGLRGFDERETVSLLGGHNIGKIGCEFILERLHNFLGTGQPDPTISADFLSEMRRNCGDSQTSSNSSSGSPLLMESTSLTKSDLGLTYFPQLATSISSGSSFDTHYYQSLLRGRGLLYADQQLMADERTASVVRAYASDDGSAFRLDFARAMMKMSSLGILSGSDGQIRKNCSFVANGN

Retrieve as FASTA  
Remarks Complete sequence from NGS (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGCCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCCT
TCTCTCTCGACCCCCTCTCGCCCGTCCTTCTCCAGAGGAACGACGACGGTGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCTG
CGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTATTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GTTCCTCNNCCTCCTCCTT
CTTCGTCTCTGCTTTGTGGGGTTCCTCGTTTAGGGGCTGATTGCCATTGGGTTTGGGTTATTTTCTCGAGTCAGGGTTGCGATGCTTCAGTTCTCCTGGACGATAGCCATGGAAACCGCA
GCCACCCCACCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGCCCTGGGGTTGTTTCTTGTGCCGATGTTC
TCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GTACGCTCTTCTCTCGTTCCCCTCTTCCAATTTCAAGAAACTGTCCCGTCCCCTGTCATCGCCATCCGTTCATGCGGATTTCGATGAA
ATTTAGTATTCTCATATTGGCATTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
CCTCTATGTTTCCAGGCTTGCAGCTGGACGACAGCTACTTGATTAGTTTGTTCGAGCTTCTTAAGAATCTCTGTTTCTGTTTCCTTTTAACTCCTTATCCTATTCACCTCGTCTTTTGAT
GTTCGAGTCCACAGGCTGGTGGCCCATTCTATCCCCTTTTCACCGGCAGGAGAGACAGTATTCAGTCCTATTACGCAGATGCAATGGCTGAAATTCCTAAGCCAGACGATAATGTCTTCC
GGACGCTCCACCTGTTCGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GTATTATCACTAAAGTCCATCCTTCTATCTTACTTTGTGGTCGAGTTTGTTTGAACTGTG
AGTGGATAACCAGGCACTGAATTGATTAATTCTGTTGATATGAAGGAGGTCACAATATCGGCAAGATCGGTTGTGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAGC
CAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGTCAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACTA
AGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCAAGCTTTGACACCCATTATTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGATC
AGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGACGGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATAT
TGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGGCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGCCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCCT
TCTCTCTCGACCCCCTCTCGCCCGTCCTTCTCCAGAGGAACGACGACGGTGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCTG
CGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTATTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GGTTGCGATGCTTCAGTTC
TCCTGGACGATAGCCATGGAAACCGCAGCCACCCCACCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGCC
CTGGGGTTGTTTCTTGTGCCGATGTTCTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GCTGGTGGCCCATTCTATCCCCTTTTCACCGGCAGGAGAGACAGTATTCAGTCCTATTACG
CAGATGCAATGGCTGAAATTCCTAAGCCAGACGATAATGTCTTCCGGACGCTCCACCTGTTCGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GAGGTCACAATATCG
GCAAGATCGGTTGTGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAGCCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGTC
AGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACTAAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCAA
GCTTTGACACCCATTATTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGATCAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGACG
GATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATATTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGGCAATTGA

Retrieve as FASTA