Entry information : OsPrx82(LOC_Os06g33080)
Entry ID 1092
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx82(LOC_Os06g33080)
Name OsPrx82(LOC_Os06g33080)
Class Class III peroxidase    [Orthogroup: Prx231]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx82
start..stop
S start..stop
OsPrx81 612 0 1..338 1..338
OsPrx[P]81 464 6e-167 83..328 1..246
OsPrx83 412 2e-145 36..338 33..334
OsPrx85 380 9e-133 6..336 5..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18911311..18911556 246 N° 2 18910447..18911217 771  
complement(join(18910447..18911217,18911311..18911556))


exon

Literature and cross-references OsPrx82(LOC_Os06g33080)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q654F7
DNA ref. GenBank:   NC_008399.1 (18911556..18910450)
Protein sequence: OsPrx82(LOC_Os06g33080)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (311)
PWM (Da):   %s   36972.02 (34359.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.12 (4.90) Peptide Signal:   %s   cut: 28 range:28-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFRCKGGVAWVALLVAVAALASAAQGFPNPFGHEEFTESYYDETCPNAQSIVRSVMERHAAANPRTAPAILRLFFHDCFVNGCDASILLNATDSMESEKDAKPNASVVGYDVIEDIKSELERSCPATVSCADVLALAARDAVAMLGGPSWGVLLGRKDSLAARMDMANKDLPRPTDSLAELIRMFKENNLDERDLTALSGAHTVGRTHSCEHYEERIYSLVGQGGDSIDPSFAAQRRQECEQKHGNATAPFDERTPAKFDNAYYVDLLARRGLLTSDQELYTQGCETGDLVKTYAMNGDVFFADFARAMVKMGNIRPKHWWTPTEVRLKCSVANTHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTAGGTGTAAGGGCGGCGTCGCTTGGGTTGCTCTGCTCGTCGCTGTCGCGGCTCTCGCCTCCGCCGCTCAGGGATTTCCAAATCCCTTCGGTCACGAGGAGTTCACGGAGAGT
TACTACGACGAGACGTGCCCCAACGCGCAGAGCATCGTGCGCTCGGTCATGGAGCGCCACGCCGCCGCCAACCCCCGCACGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTC
GTCAAC
GTAAGTACACCACAATCTCTCGATCGTACGAGGAGGCCACCATTAGAGCATCACGAAATGCATTTGTCTAACAATCATCGGTGACATTTGCAGGGTTGTGATGCCTCCATCCTT
CTGAACGCTACGGACTCCATGGAGAGCGAGAAGGACGCCAAGCCCAACGCCTCCGTCGTCGGCTACGACGTGATCGAAGACATCAAGTCGGAACTCGAGCGCAGCTGCCCGGCCACCGTC
TCCTGCGCTGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCCATGCTCGGCGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCCCTCGCCGCCCGCATGGACATGGCCAAC
AAGGATCTCCCGAGACCGACAGACAGCCTAGCCGAGCTCATCAGGATGTTCAAGGAGAACAACCTCGACGAGCGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAGGACGCAC
AGCTGCGAGCACTACGAGGAACGCATCTACAGCCTCGTTGGCCAGGGCGGCGACAGCATCGACCCCTCATTCGCGGCGCAACGCAGGCAGGAGTGCGAGCAGAAGCACGGCAACGCCACG
GCGCCGTTCGATGAGCGGACGCCAGCCAAGTTCGACAACGCCTACTACGTCGACTTGCTTGCGAGGCGCGGGCTCCTCACATCCGACCAGGAGCTCTACACCCAGGGGTGCGAGACCGGC
GACCTGGTGAAGACGTACGCCATGAACGGCGATGTGTTCTTCGCCGACTTCGCGAGGGCCATGGTTAAGATGGGGAACATACGGCCGAAGCATTGGTGGACTCCGACGGAGGTCAGGCTC
AAGTGCTCGGTGGCCAACACCCATTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTAGGTGTAAGGGCGGCGTCGCTTGGGTTGCTCTGCTCGTCGCTGTCGCGGCTCTCGCCTCCGCCGCTCAGGGATTTCCAAATCCCTTCGGTCACGAGGAGTTCACGGAGAGT
TACTACGACGAGACGTGCCCCAACGCGCAGAGCATCGTGCGCTCGGTCATGGAGCGCCACGCCGCCGCCAACCCCCGCACGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTC
GTCAAC
GGTTGTGATGCCTCCATCCTTCTGAACGCTACGGACTCCATGGAGAGCGAGAAGGACGCCAAGCCCAACGCCTCCGTCGTCGGCTACGACGTGATCGAAGACATCAAGTCGGAA
CTCGAGCGCAGCTGCCCGGCCACCGTCTCCTGCGCTGATGTTCTCGCGCTCGCCGCCCGCGACGCCGTCGCCATGCTCGGCGGGCCCAGCTGGGGCGTGCTCCTCGGCCGCAAGGACTCC
CTCGCCGCCCGCATGGACATGGCCAACAAGGATCTCCCGAGACCGACAGACAGCCTAGCCGAGCTCATCAGGATGTTCAAGGAGAACAACCTCGACGAGCGCGACCTCACCGCGCTCTCC
GGCGCGCACACCGTCGGCAGGACGCACAGCTGCGAGCACTACGAGGAACGCATCTACAGCCTCGTTGGCCAGGGCGGCGACAGCATCGACCCCTCATTCGCGGCGCAACGCAGGCAGGAG
TGCGAGCAGAAGCACGGCAACGCCACGGCGCCGTTCGATGAGCGGACGCCAGCCAAGTTCGACAACGCCTACTACGTCGACTTGCTTGCGAGGCGCGGGCTCCTCACATCCGACCAGGAG
CTCTACACCCAGGGGTGCGAGACCGGCGACCTGGTGAAGACGTACGCCATGAACGGCGATGTGTTCTTCGCCGACTTCGCGAGGGCCATGGTTAAGATGGGGAACATACGGCCGAAGCAT
TGGTGGACTCCGACGGAGGTCAGGCTCAAGTGCTCGGTGGCCAACACCCATTATTGA

Retrieve as FASTA