Entry information : OsPrx84(LOC_Os06g32980)
Entry ID 1094
Creation 2008-09-02 (Christophe Dunand)
Last sequence changes 2008-09-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx84(LOC_Os06g32980)
Name OsPrx84(LOC_Os06g32980)
Class Class III peroxidase    [Orthogroup: Prx095]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx84
start..stop
S start..stop
OsPrx85 546 0 1..329 1..322
TaPrx28 379 1e-132 37..329 28..323
BdiPrx26 379 2e-132 37..329 28..322
OsPrx81 377 1e-131 37..329 36..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18852659..18852895 237 N° 2 18851809..18852561 753  
complement(join(18851809..18852561,18852659..18852895))


exon

Literature and cross-references OsPrx84(LOC_Os06g32980)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z9B3
DNA ref. GenBank:   NC_008399.1 (18852895..18851812)
mRNA ref. GenBank:   NM_001064280.1
Cluster/Prediction ref. UniGene:   Os.80455
Protein sequence: OsPrx84(LOC_Os06g32980)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   36219.88 (33740.5)  
PI (pH):   %s   5.6 (5.59) Peptide Signal:   %s   cut: 26 range:26-329
Sequence 370
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGISKSFFVASLSLLLAVLASTGEGSHQPVVMPVAMELSAKYYRKTCPNVQNAVRTVMEHRLDMAPAVLRLFFHDCFVNGCDASVLLNRTDTMESEKDAEPANTSLAGFDVIDEIKSVLEHDCPATVSCADILALASRDAVALLGGPRWSVPLGRMDSRQASKAVAEDANNLPNPNSDLGELLRVFETHGLDARDFTALSGAHTVGKAHSCDNYRDRVYGDHNIDPSFAALRRRSCEQGRGEAPFDEQTPMRFDNKYYQDLLHRRGLLTSDQELYTHGGEVTSELVELYAKSRKAFFADFARAMVKMGEIRPPEWIPVEVRLNCGMVNN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATCTCGAAGAGTTTCTTCGTCGCTTCGCTTTCTCTGCTCCTCGCGGTTCTCGCGTCCACCGGCGAGGGAAGCCACCAGCCGGTCGTAATGCCGGTGGCGATGGAGCTGTCTGCC
AAGTACTACAGGAAGACGTGCCCCAACGTGCAGAACGCCGTGCGCACGGTGATGGAGCACAGGCTGGACATGGCGCCGGCCGTCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GTA
AGTATATGTACTAGTCTCGTACTGCACGACACCCCATATGAGAGGAGAATGCACAAATGCTTTTGTGTCTCACAATCATCCATGACACATTTAGGGTTGTGACGCCTCTGTTCTTCTGAA
CCGGACGGACACCATGGAGAGCGAGAAGGACGCCGAGCCGGCCAACACCTCGCTCGCCGGGTTCGACGTCATCGACGAGATCAAGTCGGTGCTGGAGCACGACTGCCCGGCCACCGTCTC
CTGCGCCGACATCCTCGCGCTCGCCTCCCGCGACGCCGTCGCCCTCCTCGGCGGGCCGAGATGGAGCGTGCCGCTCGGCCGCATGGACTCGCGGCAAGCCAGCAAAGCGGTCGCCGAGGA
CGCCAACAACCTCCCGAACCCGAACAGCGATCTCGGCGAGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACTTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGC
CCACAGCTGCGACAACTACAGGGACCGCGTCTATGGCGACCACAATATCGACCCCTCATTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCAGAGGCGAGGCGCCGTTCGACGAGCA
GACGCCGATGAGGTTCGACAACAAATACTACCAGGACCTGCTCCATCGGCGCGGGCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAGGTAACTAGTGAGCTTGTGGAGCT
GTACGCGAAGAGCCGTAAGGCGTTCTTCGCGGACTTCGCGAGGGCGATGGTGAAGATGGGGGAGATACGCCCGCCGGAGTGGATTCCGGTGGAGGTGAGGCTCAACTGCGGGATGGTCAA
CAATTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATCTCGAAGAGTTTCTTCGTCGCTTCGCTTTCTCTGCTCCTCGCGGTTCTCGCGTCCACCGGCGAGGGAAGCCACCAGCCGGTCGTAATGCCGGTGGCGATGGAGCTGTCTGCC
AAGTACTACAGGAAGACGTGCCCCAACGTGCAGAACGCCGTGCGCACGGTGATGGAGCACAGGCTGGACATGGCGCCGGCCGTCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GGT
TGTGACGCCTCTGTTCTTCTGAACCGGACGGACACCATGGAGAGCGAGAAGGACGCCGAGCCGGCCAACACCTCGCTCGCCGGGTTCGACGTCATCGACGAGATCAAGTCGGTGCTGGAG
CACGACTGCCCGGCCACCGTCTCCTGCGCCGACATCCTCGCGCTCGCCTCCCGCGACGCCGTCGCCCTCCTCGGCGGGCCGAGATGGAGCGTGCCGCTCGGCCGCATGGACTCGCGGCAA
GCCAGCAAAGCGGTCGCCGAGGACGCCAACAACCTCCCGAACCCGAACAGCGATCTCGGCGAGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACTTCACCGCGCTCTCC
GGCGCGCACACCGTCGGCAAGGCCCACAGCTGCGACAACTACAGGGACCGCGTCTATGGCGACCACAATATCGACCCCTCATTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCAGA
GGCGAGGCGCCGTTCGACGAGCAGACGCCGATGAGGTTCGACAACAAATACTACCAGGACCTGCTCCATCGGCGCGGGCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAG
GTAACTAGTGAGCTTGTGGAGCTGTACGCGAAGAGCCGTAAGGCGTTCTTCGCGGACTTCGCGAGGGCGATGGTGAAGATGGGGGAGATACGCCCGCCGGAGTGGATTCCGGTGGAGGTG
AGGCTCAACTGCGGGATGGTCAACAATTG

Retrieve as FASTA