Entry information : OsPrx85(LOC_Os06g32960)
Entry ID 1095
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx85(LOC_Os06g32960)
Name OsPrx85(LOC_Os06g32960)
Class Class III peroxidase    [Orthogroup: Prx091]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx85
start..stop
S start..stop
OsPrx84 534 0 29..322 37..329
TaPrx28 390 7e-137 29..322 28..323
BdiPrx27 388 4e-136 12..321 9..325
OsPrx81 385 4e-135 29..322 36..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18846638..18846850 213 N° 2 18846934..18847689 756  
join(18846638..18846850,18846934..18847689)


exon

Literature and cross-references OsPrx85(LOC_Os06g32960)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z9B5
DNA ref. GenBank:   NC_008399.1 (18846638..18847686)
Protein sequence: OsPrx85(LOC_Os06g32960)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (299)
PWM (Da):   %s   35595.36 (33184.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   4.68 (4.62) Peptide Signal:   %s   cut: 24 range:24-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSKGLFVASFTLFLLVALAFADESRPELSPAYYKKTCPNLENAVRTVMSQRMDMAPAILRLFFHDCFVNGCDASVLLDRTDSMEREKDAEPANTSLAGFDVIDEIKSVLEHDCPATVSCADILGLASRDAVALLGGPSWSVPLGRMDSRRASKDDAESVDNLPNPNSDLGELLRVFETHGLDARDLTALSGAHTVGKAHSCDNYRDRIYGANNDNIDPSFAALRRRSCEQGGGEAPFDEQTPMRFDNKYFQDLLQRRGLLTSDQELYTHGGEVSDLVEMYATNREAFFADFARAMVKMGNIRPPQWMPLEVRLNCRMVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGTCCAAGGGTCTCTTCGTCGCTTCGTTTACGCTATTTCTCCTCGTGGCTCTGGCGTTCGCCGACGAGAGCAGGCCGGAGCTCTCACCGGCGTACTACAAGAAGACGTGCCCC
AACCTGGAGAACGCCGTGCGCACGGTGATGTCGCAGAGGATGGACATGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GTAAGTAGTATATCACTCTCTCATAGT
AGGTAGGAGGACGCCATTACGAGTGCTTTTATCTCACAATATTCGATGGCATGCAGGGATGTGATGCCTCTGTTCTTCTTGACCGGACGGACTCCATGGAGAGAGAGAAAGACGCCGAGC
CGGCCAACACCTCGCTCGCCGGATTCGACGTCATCGACGAGATCAAGTCGGTGCTCGAGCACGACTGCCCGGCCACCGTCTCCTGCGCCGACATCCTCGGGCTCGCCTCCCGCGACGCCG
TCGCCCTCCTCGGCGGGCCCAGCTGGAGCGTGCCGCTCGGCCGCATGGACTCGCGCCGAGCCAGCAAAGACGACGCCGAGAGCGTCGACAACCTCCCGAACCCGAACAGCGATCTCGGCG
AGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGCCCACAGCTGCGACAACTACAGGGACCGCATCTACGGCG
CCAACAACGACAACATCGACCCCTCCTTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCGGCGGCGAGGCGCCGTTCGACGAGCAGACGCCGATGCGGTTCGACAACAAGTACTTCC
AGGACTTGCTCCAGCGGCGCGGCCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAGGTAAGCGACCTGGTGGAGATGTACGCGACGAACCGCGAGGCGTTCTTCGCGGACT
TCGCGAGGGCGATGGTGAAGATGGGGAACATACGCCCGCCGCAGTGGATGCCACTGGAGGTGAGGCTCAACTGCAGGATGGTCAACAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGTCCAAGGGTCTCTTCGTCGCTTCGTTTACGCTATTTCTCCTCGTGGCTCTGGCGTTCGCCGACGAGAGCAGGCCGGAGCTCTCACCGGCGTACTACAAGAAGACGTGCCCC
AACCTGGAGAACGCCGTGCGCACGGTGATGTCGCAGAGGATGGACATGGCGCCGGCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GGATGTGATGCCTCTGTTCTTCTTGAC
CGGACGGACTCCATGGAGAGAGAGAAAGACGCCGAGCCGGCCAACACCTCGCTCGCCGGATTCGACGTCATCGACGAGATCAAGTCGGTGCTCGAGCACGACTGCCCGGCCACCGTCTCC
TGCGCCGACATCCTCGGGCTCGCCTCCCGCGACGCCGTCGCCCTCCTCGGCGGGCCCAGCTGGAGCGTGCCGCTCGGCCGCATGGACTCGCGCCGAGCCAGCAAAGACGACGCCGAGAGC
GTCGACAACCTCCCGAACCCGAACAGCGATCTCGGCGAGCTCCTCAGGGTGTTCGAGACGCACGGCCTCGACGCCCGCGACCTCACCGCGCTCTCCGGCGCGCACACCGTCGGCAAGGCC
CACAGCTGCGACAACTACAGGGACCGCATCTACGGCGCCAACAACGACAACATCGACCCCTCCTTCGCCGCGCTCCGCCGGCGGTCGTGCGAGCAGGGCGGCGGCGAGGCGCCGTTCGAC
GAGCAGACGCCGATGCGGTTCGACAACAAGTACTTCCAGGACTTGCTCCAGCGGCGCGGCCTCCTCACCTCCGACCAGGAGCTCTACACCCATGGCGGGGAGGTAAGCGACCTGGTGGAG
ATGTACGCGACGAACCGCGAGGCGTTCTTCGCGGACTTCGCGAGGGCGATGGTGAAGATGGGGAACATACGCCCGCCGCAGTGGATGCCACTGGAGGTGAGGCTCAACTGCAGGATGGTC
AACAATTGA

Retrieve as FASTA