Entry information : OsPrx86(LOC_Os06g35520)
Entry ID 1096
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx86(LOC_Os06g35520)
Name OsPrx86(LOC_Os06g35520)
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Leaves
Roots
Shoots
Inducers Fungus infection
Magnaporthe grisea infection
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx86
start..stop
S start..stop
SbPrx138 563 0 64..363 26..325
SiPrx33 558 0 67..363 29..325
TaPrx32 552 0 54..363 14..322
BdiPrx23 533 0 43..363 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20358787..20359134 348 N° 2 20358478..20358669 192 N° 3 20357830..20358381 552  
complement(join(20357830..20358381,20358478..20358669,20358787..20359134))


exon

Literature and cross-references OsPrx86(LOC_Os06g35520)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z7J2
DNA ref. GenBank:   NC_008399.1 (20359017..20357833)
Protein sequence: OsPrx86(LOC_Os06g35520)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (295)
PWM (Da):   %s   38196.11 (31298.4) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.09 (8.21) Peptide Signal:   %s   cut: 30 range:30-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAHYKLEATPVRLVPSNSSQDRVVYVCSVLLSLLPCVEMAGVVITGRALVAAVAVVVAVLLGGAAEAQQLSPNFYSRTCPNLATIVRSGMASAVRTEPRMGASILRLFFHDCFVNGCDGSILLDDTSTFTGEKSAGPNANSARGFEVIDAIKTQVEASCKATVSCADILALAARDGVNLLGGPTWSVALGRKDSRTASQSAANSNLPGPGSSLATLISMFGNQGLSARDMTALSGAHTIGRAQCQFFRSRIYTERNINASFASLRQQTCPRSGGDANLAPFDVQTPDAFDNAYYQNLVSQRGLLHSDQELFNGGSQDGLVRQYSTNPSQFSSDFVSAMVKMGNLLPSSGTATEVRLNCRKVN*

Retrieve as FASTA  
Remarks chromosome 6. 22 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACACTATAAATTGGAGGCCACCCCTGTGCGTCTCGTCCCATCCAACTCATCTCAGGATCGAGTTGTGTACGTTTGTAGTGTGCTGCTCTCTCTGCTACCTTGTGTCGAGATG
GCCGGAGTGGTGATCACCGGGCGGGCCTTGGTGGCCGCCGTCGCTGTCGTGGTCGCCGTTTTGCTCGGCGGAGCGGCGGAGGCGCAGCAGCTGTCCCCCAACTTCTACTCGAGGACGTGC
CCCAACCTGGCCACCATCGTGCGGTCCGGGATGGCGTCCGCCGTGCGGACGGAGCCCCGGATGGGGGCCTCCATCCTTCGCCTCTTCTTCCATGATTGCTTCGTCAAT
GTAATTAAGCAA
CGCAACATTATTTTTAATTAATTTTTTTGGCTGGTGCTGTTGCTGATGAATGATCATGAGCTCATGAGTTATGGTTTTATGGTTGTCTGGTGGGGTTGGTTGCAGGGATGTGACGGCTCG
ATCCTGCTTGACGACACGTCGACGTTCACCGGCGAGAAGAGCGCCGGCCCGAACGCCAACTCGGCCCGCGGGTTCGAGGTGATCGACGCCATCAAGACGCAGGTGGAGGCCTCCTGCAAG
GCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGCGACGGCGTCAACCTG
GTCAGTGTACTACATACGCTGCTCTGACACGTACGTGAAACCACCCGTACGTCACTGAAATTT
TACCAGTGGCTGACATGTTCTTTTGGTGTGCAGCTGGGTGGGCCAACGTGGAGCGTGGCGCTGGGGCGGAAGGACTCGCGCACGGCGAGCCAGAGCGCGGCGAACAGCAACCTGCCGGGG
CCCGGGTCGAGCCTCGCCACGCTCATCAGCATGTTCGGCAACCAGGGCCTCTCGGCGCGCGACATGACGGCGCTGTCGGGCGCCCACACCATCGGCCGCGCCCAGTGCCAGTTCTTCCGC
AGCCGCATCTACACCGAGCGCAACATCAACGCCTCCTTCGCGTCGCTCCGGCAGCAGACGTGCCCGCGCTCCGGCGGCGACGCCAACCTCGCGCCGTTCGACGTGCAGACGCCCGACGCC
TTCGACAACGCCTACTACCAGAACCTCGTGTCGCAGCGCGGCCTGCTCCACTCCGACCAGGAGCTCTTCAATGGCGGCTCGCAGGACGGCCTCGTCAGGCAGTACAGCACCAACCCCTCC
CAGTTCTCCTCCGACTTCGTCTCCGCCATGGTCAAGATGGGCAACCTGCTGCCGTCCTCCGGCACCGCCACGGAGGTCAGGCTCAACTGCAGGAAGGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACACTATAAATTGGAGGCCACCCCTGTGCGTCTCGTCCCATCCAACTCATCTCAGGATCGAGTTGTGTACGTTTGTAGTGTGCTGCTCTCTCTGCTACCTTGTGTCGAGATG
GCCGGAGTGGTGATCACCGGGCGGGCCTTGGTGGCCGCCGTCGCTGTCGTGGTCGCCGTTTTGCTCGGCGGAGCGGCGGAGGCGCAGCAGCTGTCCCCCAACTTCTACTCGAGGACGTGC
CCCAACCTGGCCACCATCGTGCGGTCCGGGATGGCGTCCGCCGTGCGGACGGAGCCCCGGATGGGGGCCTCCATCCTTCGCCTCTTCTTCCATGATTGCTTCGTCAAT
GGATGTGACGGC
TCGATCCTGCTTGACGACACGTCGACGTTCACCGGCGAGAAGAGCGCCGGCCCGAACGCCAACTCGGCCCGCGGGTTCGAGGTGATCGACGCCATCAAGACGCAGGTGGAGGCCTCCTGC
AAGGCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGCGACGGCGTCAACCTG
CTGGGTGGGCCAACGTGGAGCGTGGCGCTGGGGCGGAAGGACTCGCGCACGGCGAGCCAG
AGCGCGGCGAACAGCAACCTGCCGGGGCCCGGGTCGAGCCTCGCCACGCTCATCAGCATGTTCGGCAACCAGGGCCTCTCGGCGCGCGACATGACGGCGCTGTCGGGCGCCCACACCATC
GGCCGCGCCCAGTGCCAGTTCTTCCGCAGCCGCATCTACACCGAGCGCAACATCAACGCCTCCTTCGCGTCGCTCCGGCAGCAGACGTGCCCGCGCTCCGGCGGCGACGCCAACCTCGCG
CCGTTCGACGTGCAGACGCCCGACGCCTTCGACAACGCCTACTACCAGAACCTCGTGTCGCAGCGCGGCCTGCTCCACTCCGACCAGGAGCTCTTCAATGGCGGCTCGCAGGACGGCCTC
GTCAGGCAGTACAGCACCAACCCCTCCCAGTTCTCCTCCGACTTCGTCTCCGCCATGGTCAAGATGGGCAACCTGCTGCCGTCCTCCGGCACCGCCACGGAGGTCAGGCTCAACTGCAGG
AAGGTGAACTAA

Retrieve as FASTA