Entry information : OsPrx87(LOC_Os06g35490)
Entry ID 1097
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx87(LOC_Os06g35490)
Name OsPrx87(LOC_Os06g35490)
Class Class III peroxidase    [Orthogroup: Prx172]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx87
start..stop
S start..stop
BdiPrx24 540 0 1..327 1..318
SbPrx137 513 0 34..327 26..318
ZmPrx76 492 2e-177 34..327 26..318
OsPrx88 459 2e-164 29..327 21..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20343689..20343925 237 N° 2 20343400..20343591 192 N° 3 20342756..20343310 555  
complement(join(20342756..20343310,20343400..20343591,20343689..20343925))


exon

Literature and cross-references OsPrx87(LOC_Os06g35490)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5Z7J7
DNA ref. GenBank:   NC_008399.1 (20343925..20342759)
Protein sequence: OsPrx87(LOC_Os06g35490)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (298)
PWM (Da):   %s   33842.07 (30841.5)  
PI (pH):   %s   8.7 (8.74) Peptide Signal:   %s   cut: 30 range:30-327
Sequence 368
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFLFARSSGYSFVALALLACVLLAPCQAAKAGLSIKFYAKTCPGVDTIVRSVVAQAVAKEPRMGASIIRLFFHDCFVNGCDASILLDDTLTFTGEKNAGANINSVRGYEVIDAIKSQVEAACKGVVSCADIVALASRDAVNLLGGPTWNVQLGRKDSRTASGTAANANLPGPASSGASLVAAFAGKGLSAREMTALSGAHTVGRARCLMFRGRIYGEANINATFAAALRQTCPQSGGGDGNLAPFDDQTPDAFDNAYFKNLVAQRGLLHSDQELFNGGSQDALVRKYAGNAGMFAGDFAKAMVKMGGLMPAAGTPTEVRLNCRKVN

Retrieve as FASTA  
Remarks chromosome 6. No ESTs. Incorrect prediction from Phytozome (splicing error, extra short exon in 3')
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCTTGTTTGCCAGGAGCAGCGGCTACAGCTTTGTTGCTCTTGCCCTCCTGGCGTGCGTGCTGCTGGCGCCGTGCCAGGCGGCGAAGGCGGGGCTCTCGATCAAGTTCTACGCC
AAGACGTGCCCCGGCGTGGACACCATCGTGCGGTCGGTGGTGGCGCAGGCCGTCGCCAAGGAGCCCCGGATGGGCGCCTCCATCATCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GTA
CGTCAGTCGTCGCGTTTGTTCTGATGATGATCTCTAGCTGACGAGATGGTCGAGTCACGCTCACGCGTGCGTTACGTTTTTTTGGCGAATGCAGGGGTGCGACGCGTCCATCCTCCTCGA
CGACACGCTGACGTTCACAGGCGAGAAGAACGCCGGCGCCAACATCAACTCCGTGCGCGGGTACGAGGTCATCGACGCCATCAAGTCCCAGGTCGAGGCGGCCTGCAAGGGCGTCGTCTC
CTGCGCCGATATCGTCGCGCTGGCGTCTCGCGACGCCGTAAACTTG
GTCAGTGAACACACGAGACGAGTGTGTGTAGACGTCATAGTGACACAGTGCACATTGAATAATCTTGATTGCAA
TAATCTGCGTTGCAGCTCGGGGGACCGACGTGGAACGTGCAGCTGGGCAGGAAGGACTCGCGCACGGCGAGCGGGACCGCGGCGAACGCCAACCTGCCCGGCCCGGCGTCCAGCGGGGCG
TCGCTCGTGGCAGCGTTCGCGGGGAAGGGCCTCTCGGCGCGCGAGATGACGGCGCTGTCCGGGGCGCACACCGTGGGGCGGGCGCGCTGCCTCATGTTCCGCGGCCGCATCTACGGGGAG
GCCAACATCAACGCCACGTTCGCCGCCGCGCTGCGGCAGACGTGCCCGCAGTCCGGCGGCGGCGACGGCAACCTAGCGCCGTTCGACGACCAGACGCCCGACGCGTTCGACAACGCCTAC
TTCAAGAACCTGGTGGCGCAGCGCGGCCTGCTGCACTCCGACCAGGAGCTGTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGAAGTACGCCGGGAACGCCGGCATGTTCGCCGGCGAC
TTCGCCAAGGCGATGGTGAAGATGGGCGGCCTCATGCCGGCGGCCGGGACGCCGACGGAGGTCAGGCTGAACTGCCGGAAGGTGAACTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTCTTGTTTGCCAGGAGCAGCGGCTACAGCTTTGTTGCTCTTGCCCTCCTGGCGTGCGTGCTGCTGGCGCCGTGCCAGGCGGCGAAGGCGGGGCTCTCGATCAAGTTCTACGCC
AAGACGTGCCCCGGCGTGGACACCATCGTGCGGTCGGTGGTGGCGCAGGCCGTCGCCAAGGAGCCCCGGATGGGCGCCTCCATCATCCGCCTCTTCTTCCACGACTGCTTCGTCAAC
GGG
TGCGACGCGTCCATCCTCCTCGACGACACGCTGACGTTCACAGGCGAGAAGAACGCCGGCGCCAACATCAACTCCGTGCGCGGGTACGAGGTCATCGACGCCATCAAGTCCCAGGTCGAG
GCGGCCTGCAAGGGCGTCGTCTCCTGCGCCGATATCGTCGCGCTGGCGTCTCGCGACGCCGTAAACTTG
CTCGGGGGACCGACGTGGAACGTGCAGCTGGGCAGGAAGGACTCGCGCACG
GCGAGCGGGACCGCGGCGAACGCCAACCTGCCCGGCCCGGCGTCCAGCGGGGCGTCGCTCGTGGCAGCGTTCGCGGGGAAGGGCCTCTCGGCGCGCGAGATGACGGCGCTGTCCGGGGCG
CACACCGTGGGGCGGGCGCGCTGCCTCATGTTCCGCGGCCGCATCTACGGGGAGGCCAACATCAACGCCACGTTCGCCGCCGCGCTGCGGCAGACGTGCCCGCAGTCCGGCGGCGGCGAC
GGCAACCTAGCGCCGTTCGACGACCAGACGCCCGACGCGTTCGACAACGCCTACTTCAAGAACCTGGTGGCGCAGCGCGGCCTGCTGCACTCCGACCAGGAGCTGTTCAACGGCGGGTCG
CAGGACGCGCTGGTGAGGAAGTACGCCGGGAACGCCGGCATGTTCGCCGGCGACTTCGCCAAGGCGATGGTGAAGATGGGCGGCCTCATGCCGGCGGCCGGGACGCCGACGGAGGTCAGG
CTGAACTGCCGGAAGGTGAACTA

Retrieve as FASTA